Ipomoea (Sweetpotato/Kumara) Post-Entry Quarantine Testing Manual

Ipomoea 

(Sweetpotato/Kumara) 

Post-Entry Quarantine 

Testing Manual 

November 2012 

Plant Health and Environment Laboratory 

Investigation and Diagnostic Centres and Response 

PO Box 2095, 231 Morrin Road, Saint Johns, 

Auckland 1140, New Zealand 

Telephone: +64-9-909 3015, Facsimile: +64-9-909 5739 

www.mpi.govt.nz

Contents 

Ipomoea Post-Entry Quarantine Testing Manual 

1. SCOPE ....................................................................................................................................................... 1 

2. INTRODUCTION ..................................................................................................................................... 1 

3. IMPORT REQUIREMENTS................................................................................................................... 3 

4. PESTS ........................................................................................................................................................ 3 

4.1 Regulated pests for which generic measures are required ........................................................... 3 

4.2 Regulated pests for which specific tests are required ................................................................... 4 

5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY QUARANTINE .................... 4 

5.1 Whole plants..................................................................................................................................... 4 

5.2 Plants in tissue culture .................................................................................................................... 5 

5.3 Pollen ................................................................................................................................................ 5 

6. INSPECTION ............................................................................................................................................ 5 

7. TESTING ................................................................................................................................................... 6 

7.1 Specific tests for nursery stock ....................................................................................................... 7 

7.1.1 Graft inoculation ......................................................................................................................... 8 

7.1.2 Herbaceous indexing................................................................................................................. 10 

7.1.3 Serological and molecular assays ............................................................................................ 11 

7.1.3.1 Enzyme-linked immunosorbent assay (ELISA) .......................................................... 11 

7.1.3.2 Polymerase chain reaction (PCR)................................................................................. 12 

7.1.3.2.1 Virus reverse transcription-PCR .............................................................................. 14 

7.1.3.2.1.1 Sweet potato chlorotic stunt virus ........................................................................ 18 

7.1.3.2.1.2 Sweetpotato leaf curl virus ................................................................................... 18 

7.1.3.2.1.3 Sweetpotato mild speckling virus ......................................................................... 18 

7.1.3.2.1.4 Sweetpotato vein mosaic virus .............................................................................. 18 

7.1.3.2.1.5 Tobacco streak virus ............................................................................................. 18 

7.1.3.2.2 Phytoplasma PCR ....................................................................................................... 19 

7.1.3.2.2.2 Sweetpotato little leaf phytoplasma ................................................................... 21 

7.1.3.2.3 Bacteria PCR .............................................................................................................. 21 

7.1.3.2.3.1 Dickeya chrysanthemi .......................................................................................... 21 

7.1.4 Bacterial isolation on media ..................................................................................................... 22 

7.1.4.1 Dickeya chrysanthemi (basonym. Erwinia chrysanthemi) ........................................... 22 

7.1.5 Microscopic inspection for mites ............................................................................................. 23 

7.1.5.1 Tetranychus evansi ......................................................................................................... 23 

8. CONTACT POINT ................................................................................................................................. 24 

9. ACKNOWLEDGEMENTS .................................................................................................................... 24 

10. REFERENCES ........................................................................................................................................ 24 

Appendix 1. Symptoms of significant regulated pests of Ipomoea batatas .................................................. 27 

1.1 Meliodogyne incognita ................................................................................................................... 27 

1.2 Rotylenchulus reniformis ............................................................................................................... 27 

1.3 Tetranychus evansi ......................................................................................................................... 27 

1.4 Plant damage caused by mites ...................................................................................................... 27 

1.5 Streptomyces ipomoea .................................................................................................................... 28 

1.6 Elsinoë batatas ................................................................................................................................ 28 

Ipomoea Post-Entry Quarantine Testing Manual · November 2012 

ii

1.7 Dickeya chrysanthemi .................................................................................................................... 28 

1.8 Ipomoea batatas infected with a mixture of viruses .................................................................... 29 

1.9 Sweetpotato chlorotic stunt virus ................................................................................................... 29 

1.10 Sweetpotato leaf curl virus ............................................................................................................. 29 

1.11 Sweetpotato little leaf phytoplasma ............................................................................................. 29 

Appendix 2. Virus symptoms on graft inoculated Ipomoea setosa ............................................................... 30 

2.1 Sweetpotato chlorotic stunt virus + Sweetpotato feathery mottle virus ......................................... 30 

2.2 Sweetpotato virus 2 ......................................................................................................................... 30 

2.3 Sweetpotato virus C6....................................................................................................................... 30 

2.4 Sweetpotato leaf curl virus ............................................................................................................. 31 

2.5 Sweetpotato leaf curl virus + Sweetpotato virus 2 ......................................................................... 31 

2.6 Sweetpotato leaf curl virus + Sweetpotato feathery mottle virus ................................................... 31 

Appendix 3. Protocols referenced in manual ................................................................................................. 32 

3.1 Silica-milk RNA extraction protocol ............................................................................................ 32 

3.2 Phytoplasma DNA enrichment CTAB extraction protocol ........................................................ 32 

©Ministry for Primary Industries, November, 2012 


iii

1. SCOPE 

The scope of this manual is limited to Ipomoea batatas and Ipomoea setosa nursery stock 

(whole plants and plants in tissue culture), seed for sowing and pollen of Ipomoea species 

permitted entry into New Zealand as listed in the Ministry for Primary Industries (MPI) 

Plants Biosecurity Index (http://www.maf.govt.nz/cgi-bin/bioindex/bioindex.pl). At the date 

of publication of this manual, these species were as follows: 

Ipomoea alba 

Ipomoea aquatica 

Ipomoea arborescens 

Ipomoea batatas 

Ipomoea brasiliensis 

Ipomoea cairica 

Ipomoea carnea 

Ipomoea horsfalliae 

Ipomoea imperialis 

Ipomoea lobata 

Ipomoea minuta 

Ipomoea nil 


Ipomoea noctiflora 

Ipomoea palmata (syn. Ipomoea cairica) 

Ipomoea pes-caprae 

Ipomoea platensis 

Ipomoea purpurea 

Ipomoea quamoclit 

Ipomoea sepacuitensis 

Ipomoea setosa 

Ipomoea sloteri 

Ipomoea tricolor 

Ipomoea tuberosa (syn. Merremia 

tuberosa) 

Note: The importation of Ipomoea caerulea, Ipomoea hederacea, Ipomoea indica, 

Ipomoea learii (syn. Ipomoea indica), Ipomoea plebeia and Ipomoea triloba is prohibited. 

This manual describes the testing requirements specified in the import health standards for 

Ipomoea. The manual also provides an introduction to the crop and guidance on the 

establishment and maintenance of healthy plants in quarantine. 

2. INTRODUCTION 

Sweetpotato (Ipomoea batatas (L.) Lam.), a member of the family Convolvulaceae, probably 

originated in Central or South America, where it has been a food source for over 55,000 

years. Sweetpotato was taken to Spain and early Spanish explorers are believed to have taken 

it to the Philippines and East Indies; from there it was soon carried to India, China, and 

Malaysia by Portuguese voyagers. It is not fully known how sweetpotato arrived in 

Polynesia, but it has been used on many of the islands in the South Pacific Ocean for at least 

2000 years (Clark & Moyer, 1988). 

Sweetpotato is grown in a wide range of environments under a range of farming systems, 

from the humid tropics to mild temperate zones, and from sea level to 2700 m altitude. 

Annual global production of sweetpotato currently exceeds 124 million tonnes. More than 

95% of the global sweetpotato crop is grown in developing countries. China is the world's 

largest producer, accounting for more than 90%. Vietnam, Indonesia, and Uganda all grow 

more than two million tonnes per year. India and Rwanda each harvest more than a million 

tonnes annually. Of the 82 developing countries where sweetpotatoes grow, 36 are in Africa, 

22 in Asia, and 24 in Latin America. Around 40 countries count sweetpotato among the five 

most important food crops produced on an annual basis. 

1

The per capita income provided by sweetpotato is one of the lowest among the major food 

crops. Its potential benefit to poor farm households and urban consumers is only now being 

considered. Sweetpotato actually produces more edible energy per hectare per day than any 

other major food crop. 

Sweetpotato is a perennial plant cultivated as an annual crop and propagated vegetatively. 

The sweetpotato plant is a prostrate vine system that expands horizontally and develops a 

shallow canopy. The sweetpotato plant produces several different types of thick and thin 

roots. Thick roots can differentiate into either ‘pencil roots’ or ‘storage roots’, the latter 

being used for human consumption. Sweetpotatoes are not tubers as they are initiated at the 

first stem node below the soil line, to which they are attached by a stalk of thinner root (Clark 

& Moyer, 1988). 

Although known for its tolerance to drought and its sensitivity to saturated soil condition, 

sweetpotato requires sufficient water and nutrients to produce good yield. Non-rooted stem 

cuttings (20-40 cm) with 5-8 nodes are harvested from storage roots laid out in nursery beds, 

and transplanted into the field. Sweetpotato can be cultivated continuously throughout the 

year in tropical regions, but in temperate regions the crop is planted in spring when the risk of 

frost is reduced. The crop requires a minimum frost-free period of 120-150 days and average 

daily temperatures of 22-24ºC along with good rainfall and good drainage (Clark & Moyer, 

1988). 

The flesh of sweetpotato can be white, purple, orange or yellow. Yellow and orange-fleshed 

varieties are valuable for their carotene (provitamin A) content. Skin colour ranges from 

nearly white through shades of buff to brown, or through pink to copper, even magenta and 

purple. 

In New Zealand, sweetpotato (known as kumara) is a crop of cultural importance and an 

important food source. Kumara was introduced by Maori when they settled in New Zealand 

from Polynesia. Cultivation of this crop was undertaken on a large scale because of its 

importance as a food source. With the arrival of European settlers, other carbohydrate crops 

such as potato, wheat, and corn displaced sweetpotato in dietary importance but not the 

crop’s place in Maori culture. Since the 1950s, after efforts to select improved clones, 

production has steadily increased along with consumption as people rediscover kumara. 

The local cultivar Owairaka Red, released in 1954, comprises 80% of the crop. Other 

cultivars include Toka Toka Gold, selected in 1972 (14%) and Beauregard (introduced in 

1993). A range of other local varieties are also grown, usually in garden plots. 

The area around Dargaville in the Kaipara district produces 85% of the national crop. 

Smaller plantings of approximately 5% are found around Auckland and Bay of Plenty. The 

area planted annually is approximately 1,100 hectares producing about 26,500 tonnes, with 

yields averaging 20 t/ha. Plantings range in area from garden plots to 30 ha, averaging 10 ha. 

Most of New Zealand’s production is for local fresh consumption although increasing 

amounts are processed and/or exported. A thorough review of this crop and its place in New 

Zealand agriculture is presented by Lewthwaite (1997). 


2

3. IMPORT REQUIREMENTS 

The import requirements for I. batatas and I. setosa nursery stock (whole plant and plants in 

tissue culture) are set out in MPI’s import health standard “Importation of Nursery Stock” 

(http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf). Imported nursery stock must meet 

the general requirements (sections 1-2) and the specific requirements detailed in the 

“Ipomoea batatas” schedule. On arrival in New Zealand, the nursery stock must be grown 

for a minimum period of 3 months in a Level 3 post-entry quarantine facility where it will be 

inspected, treated and/or tested for regulated pests. 

The import requirements for Ipomoea seed for sowing are set out in MPI’s import health 

standard “Importation of Seed for Sowing” (http://www.biosecurity.govt.nz/files/ihs/155-02- 

05.pdf). Imported seed is only required to meet the general requirements (sections 1-2) and 

there are no specific requirements for the genus. An import permit is not required and seed 

meeting the import requirements is given biosecurity clearance at the border without the need 

for post-entry quarantine. 

The import requirements for pollen are stated in section 2.2.3 in MPI’s import health standard 

“Importation of Nursery Stock” (http://www.biosecurity.govt.nz/files/ihs/155-02-06.pdf ) and 

further details can be found in section 5.3 of this manual. 

4. PESTS 

The following section lists regulated pests of I. batatas and I. setosa nursery stock that 

require generic or specific measures. 

4.1 Regulated pests for which generic measures are required 

Insects: 

Cylas formicarius 

Cylas puncticollis 

Euscepes postfasciatus 

Nematodes: 

Meliodogyne incognita [Fig. 1.1] 

Rotylenchulus reniformis [Fig. 1.2] 

Pratylenchus coffeae 

Pratylenchus brachyurus 

Fungi: 

Elsinoë batatas [Fig. 1.6] 

Helicobasidium mompa 

Bacteria: 

Pseudomonas batatas 

Streptomyces ipomoea [Fig. 1.5] 

Xanthomonas batatae 

Xylella fastidiosa 


3

Viruses: 

Sweetpotato chlorotic fleck virus 

Sweetpotato latent virus 

Sweetpotato ringspot virus 

Sweetpotato virus C6 

[Fig. 1.8] 


[Fig. 1.8, 2.3] 

4.2 Regulated pests for which specific tests are required 

Mites: 

Tetranychus evansi [Fig. 1.3, 1.4] 

Bacteria: 

Dickeya chrysanthemi [Fig. 1.7] 

Phytoplasma: 

Sweetpotato little leaf phytoplasma [Fig. 1.11] 

Viruses: 

Sweetpotato caulimo-like virus 

Sweetpotato chlorotic stunt virus [Fig. 1.9, 2.1] 

Sweetpotato leaf curl virus [Fig. 1.10, 2.4, 2.5, 2.6] 

Sweetpotato leaf speckling virus 

Sweetpotato mild speckling virus 

Sweetpotato vein mosaic virus 

Sweetpotato yellow dwarf virus 

Tobacco streak virus 

5. PROPAGATION, CARE AND MAINTENANCE IN POST-ENTRY 

QUARANTINE 

5.1 Whole plants 

Sweetpotato plants can be grown in the glasshouse all year round as long as a day-time 

temperature between 18-26ºC is maintained. Night-time temperatures should not fall below 

12ºC to avoid chilling injury. Supplementary lighting may be required in winter. 

Sweetpotatoes require free-draining planting which is initially only moistened to avoid 

development of rots in quiescent storage roots. The plants can be watered more freely when 

the canopy has established and the plants are actively growing. The sweetpotato is a 

perennial plant and harvesting takes place when storage roots reach the desired size. 

Harvesting may be plant destructive, but if larger storage roots are removed with minimal 

plant disturbance, the remaining storage roots will continue to grow and new plants will form. 

Harvested roots should be stored in the dark at 13ºC. Storage temperatures should not fall 

below 12ºC which can cause chilling injury. Relative humidity during storage should be 

maintained at 80 to 90%. Roots stored in multi-walled paper bags can respire and maintain 

their own humid environment. Hessian or net bags should be avoided as they can cause 

abrasive injury and allow moisture and pathogen entry. 

4

Whole plants should be planted into sufficiently sized pots (eg 3 L minimum) containing 

50:50 (v/v) pasteurised peat:pumice planting media and a few grams of slow-release fertiliser 

with trace elements (e.g. Osmocote ® ). Nodal cuttings should be taken from growing vines to 

maintain the clone and facilitate quarantine examination and testing. Cuttings with one or 

two leaves and at least two nodes can be rooted directly in pasteurised pumice sand or perlite 

before transferring to planting media. It would be worth preserving clonal material in tissue 

culture as a back-up resource, and to preserve any established virus-free status. 

Plants in tissue culture 

Tissue culture plantlets can be sub-cultured after arrival by cutting into nodal sections and 

placing into new tissue culture vessels with fresh nutrient media (e.g. Murashige and Skoog 

media). 

Plantlets to be tested are carefully excised from the tissue culture vessel and washed to 

remove any remaining agar and planted into pots of planting media containing 50:50 (v/v) 

pasturised peat:perlite or 50:50 (v/v) peat:vermiculite. The plantlets must be protected from 

desiccation for approximately three weeks by covering initially with a vented plastic tub or 

bag. Alternatively, the plants can be misted regularly to keep the planting media moist, and 

to maintain a high relative humidity. Pots should be placed in bright light, but not direct 

sunlight during the three weeks. After this period, any coverings should be removed and the 

plants moved to higher light intensity. 

5.3 Pollen 

Anthers can be collected from mature but unopened flowers and dried in warm, light 

conditions. Following this drying period, pollen should be collected into a centrifuge vial or 

into gel capsules and stored at 4°C in a sealed container in the presence of a strong desiccant 

such as calcium chloride. 

6. INSPECTION 

The inspection requirements for the operator of the facility are set out in the “MPI 

Biosecurity Authority Standard PBC-NZ-TRA-PQCON” 

(http://www.biosecurity.govt.nz/files/regs/stds/pbc-nz-tra-pqcon.pdf ) 

Photographs of symptoms caused by significant regulated diseases can be found in Appendix 

1. However, please note that pot-grown sweetpotato plants can be prone to nutrient 

deficiencies if not adequately fertilised and nutrient deficiencies can resemble virus infection, 

e.g. chlorosis and necrosis. Symptoms related to nutrient deficiencies can be found in 

Appendix 2. Further information on nutrient deficiencies is described in Clark & Moyer 

(1988). 


5

7. TESTING 

Each of the specific tests required in the import health standard (as described in section 4 and 

summarised in Table 1) must be done irrespective of whether plants exhibit symptoms. This 

testing is required to detect latent infections. 

Samples should be tested as soon as possible after removal from the plant. If samples have to 

be stored before testing, the plant material must be kept whole, all surface water must be 

removed, and the material stored in a plastic bag at 4 o C. Samples that become partially 

decayed or mouldy must not be tested, and further samples should be collected. 

Inspection for mites 

Inspection for mites is performed once whole plants or tissue culture plants have established 

successfully in planting media and have produced stems with at least 10-15 nodes. 

Inspection should take place before samples are taken for other testing methods. Using a 

hand lens, the underside of all leaves must be inspected for mite eggs, nymphs, adults and 

symptoms of mite presence. Following this, the 3 youngest leaves of each plant, plus any 

suspect leaves showing the presence of mites must be collected for further examination under 

a binocular microscope. See section 7.1.5 for further details. 

Indexing tests 

Graft inoculation: Grafting can begin when the whole plants or tissue culture plants have 

established successfully in planting media and have produced stems with at least 10-15 

nodes. Grafting should take place before leaf samples are collected for other testing methods. 

See section 7.1.1 for further details. Each plant in the glasshouse must be tested individually 

by graft indexing 

Herbaceous indexing: Virus testing should be done in spring (or under spring-like 

conditions) when new growth has occurred. At least two fully expanded leaves must be 

sampled from each of two different branches of the main stem, one a younger leaf and one an 

older leaf from a mid-way position. Each plant in the glasshouse must be tested individually 

by herbaceous indexing. See section 7.1.2 for further details 

PCR and ELISA testing 

Viruses: For virus-testing of I. batatas by PCR and ELISA, it is recommended to test the 

graft-inoculated indicator plants rather than the original test plants. However, original I. 

setosa plants can be tested directly. Virus testing should be done in spring (or under springlike 

conditions) when new growth has occurred. At least two fully expanded leaves must be 

sampled from each of two different branches of the main stem, one a younger leaf and one an 

older leaf from a mid-way position. The sampled leaves from each plant must be bulked 

together and tested as soon as possible after removal from the host. See section 7.1.3 for 

further details. 

Bacteria and phytoplasma: Bacteria and phytoplasma testing must be carried out using the 

original I. batatas and I. setosa plants and should be done in summer (or under summer-like 

conditions). For each plant, at least two fully expanded leaves must be sampled from each of 

two different branches of the main stem, one a younger leaf and one an older leaf from a midway 

position. Detection of both bacteria and phytoplasma requires testing of leaf petioles 

and mid-veins. The sampled leaves from each plant must be bulked together and tested as 

soon as possible after removal from the host. See section 7.1.3 for further details 


6

Bacterial isolation on media 

Isolation of regulated bacteria testing must be carried out using the original I. batatas and I. 

setosa plants and should be done in summer (or under summer-like conditions). For each 

plant, at least two fully expanded leaves must be sampled from each of two different branches 

of the main stem, one a younger leaf and one an older leaf from a mid-way position. 

Detection of bacteria requires plating vascular tissue from petioles mid-veins. Each plant in 

the glasshouse must be tested individually. See section 7.1.4 for further details. 

Table 1: Summary of the regulated pests for I. batatas and I. setosa indicating the 

specific tests that are required (■), alternative (□) or optional () 

Organism Type Graft 

Inoculation 1 

Herbaceous 

Indexing 


ELISA PCR 

Isolation 

on media 

Inspection 

Mites 

Tetranychus evansi ■ 

Bacterium 

Dickeya chrysanthemi □ □ 

Phytoplasma 

Sweetpotato little leaf 

phytoplasma 

Viruses 

■ 

Sweetpotato caulimo-like virus ■ 

Sweetpotato chlorotic stunt 

virus 

■ ■ 

Sweetpotato leaf curl virus 2 ■ ■ 

Sweetpotato leaf speckling 

virus 

■ 

Sweetpotato mild speckling ■ 

virus 

Sweetpotato vein mosaic virus ■ □ □ 

Sweetpotato yellow dwarf virus ■ ■ 

Tobacco streak virus ■ □ □ 

1 2 

Not required for I. setosa; ssDNA Geminivirus 

7.1 Specific tests for nursery stock 

Each plant must be tested separately with the following exceptions, samples from up to 5 

plants may be bulked for testing provided that either: 

(a) the plants are derived from a single imported plant or plant established from a storage 

root from which separate cuttings have been taken upon arrival in New Zealand, in 

the presence of a MPI inspector; or 

(b) in the case of tissue culture where plants are clonal, and this is confirmed by evidence 

from the national plant protection organisation in the exporting country. 

7

7.1.1 Graft inoculation 

Each I. batatas plant must be tested by graft inoculation using a minimum of 3 replicate 

indicator plants of either I. setosa or I. nil ‘Scarlet O’ Hara’. Indicator plants must be 

maintained in a healthy, vigorous state, as symptoms associated with abiotic stresses, such as 

water and nutrient deficiencies, may mask and interfere with observations of disease 

symptoms. The indicator plants can be grown from seed or from young cuttings. If using 

seed, sow 3-4 weeks before grafting. 

Sweetpotato seed requires scarification prior to germination. Indicator seeds are soaked in 

concentrated sulphuric acid (98%) for 20 minutes (I. nil) or 60 minutes (I. batatas). Seeds 

are then rinsed in running tap water 3-4 times prior to planting in moist planting media. 

The method for propagating sweetpotato plants from seed is described in full by Saladaga et 

al. (1991). 

The indicator plants are ready for grafting when they have two or more fully expanded 

leaves. 

To avoid cross-contamination of plants during the grafting process, use a sterile scalpel for 

each sweetpotato plant to be tested. 

Recommended method 

1. Begin grafting by cutting indicator plants back to 2 true leaves. 

2. Sweetpotato plants are tested by wedge-grafting. Each sweetpotato plant that is to be 

used for indexing should be established with a minimum of five nodes. Remove a branch 

from the sweetpotato plant to be indexed and cut the branch into 5 sections, each 

containing a node with a fully expanded leaf attached. 

3. Wedge-graft each node section onto a separate indicator plant. 

4. To prevent desiccation, wrap the graft with parafilm, or similar. 

5. Cover the whole plant with a plastic bag to reduce airflow around the graft. 

6. Remove the plastic bag 5-7 days after grafting. 

7. Fertilise the indicator plant with a slow-release fertiliser (e.g. Osmocote ® ) and insert a 

bamboo-stake into the pot to support the growth of the plant. 

8. Grow the indicator plants to at least 10-15 nodes; this will take approximately 3-5 weeks. 

During the growth period, monitor the indicator plants daily for virus symptoms which 

may only show for a short period of time. 

9. Some sweetpotato grafts may grow faster than the indicator plant, cut any sweetpotato 

growth back to ensure the indicator plant grows well. 

10. At the end of the 3-5 week growth period, cut the indicator plants back to 1-2 buds and 

re-grow for 3-5 weeks. Re-growth should again be closely monitored daily for virus 

symptoms. 

11. A positive control must be included with each batch of inoculations. For the positive 

control, graft a sweetpotato plant known to be infected with a non-regulated virus, e.g. 

Sweetpotato feathery mottle virus (SPFMV). 

12. It is recommended to include a negative control with each batch of inoculations. For the 

negative indicator, cut back to 2 true leaves, as for grafted plants, but do not graft. 


8

Note: Sweetpotato plants are sensitive to some pesticides and spray damage can induce 

mosaic-like symptoms. In addition, plants suffering from nutrient deficiencies can show 

leaf chlorosis and necrosis. 

Interpretation of results 

Symptoms on I. setosa usually appear within 2-4 weeks, and on I. nil around one week. 

However, the severity of virus symptoms and length of time before they appear on the 

indicator plants depends upon the virus and the amount of virus inoculum present in the 

scion. The graft inoculation results will only be considered valid if: 

(a) no symptoms are produced on the negative control (non-grafted) indicator plant; and 

(b) the expected symptoms are produced on the indicator hosts with the positive control 

(non-regulated virus). If SPFMV was used as the positive control, the following 

symptoms will be produced on the indicator plants: 

• I. setosa – vein clearing followed by remission. 

• I. nil – systemic vein clearing, vein banding, ringspots. 

The symptoms produced by each of the regulated viruses on the indicator species I. setosa 

and I. nil are described below. 

Sweetpotato caulimo-like virus: 

• I. setosa – chlorotic flecks along the secondary veins and interveinal chlorotic spots on 

leaves. 

Sweetpotato chlorotic stunt virus: 

• I. setosa – stunting, yellowing and leaf deformation, although symptoms maybe mild 

depending on isolate. 

• I. nil – stunting, yellowing and leaf deformation, although symptoms maybe mild 

depending on isolate. 

Sweetpotato leaf curl virus: 

• I. setosa – curling of young leaves. 

• I. nil – curling of young leaves. 

Sweetpotato leaf speckling virus: 

• I. setosa – chlorotic and necrotic spotting, dwarfing and leaf curling. 

• I. nil – chlorotic and necrotic spotting, dwarfing and leaf curling. 

Sweetpotato mild speckling virus: 

• I. setosa – mild mosaic sometimes observed in first two true leaves. 

Sweetpotato vein mosaic virus: 

• I. setosa – systemic vein-clearing and mosaic. 

• I. nil – systemic vein-clearing and mosaic. 

Sweetpotato yellow dwarf virus: 

• I. setosa – chlorotic leaf mottling. 


9

7.1.2 Herbaceous indexing 

Each I. batatas and I. setosa plant must be tested for mechanically-transmitted regulated 

viruses using herbaceous indicators, this is in addition to graft inoculation. Sap must be 

inoculated onto two plants of each herbaceous species as follows: Chenopodium quinoa, 

Nicotiana benthamiana, N. clevelandii and N. tabacum. 

It is important that the pre- and post-inoculation growing conditions of the herbaceous 

indicator plants promote their susceptibility. Plants must be grown at 18-25 o C. The stage of 

development to ideally inoculate the indicator plants is 4-6 fully expanded true leaves for 

Chenopodium spp., and 4 fully expanded leaves for Nicotiana spp. 


1. Place indicator plants in dark for 16-24 hours prior to inoculation to increase 

susceptibility. 

2. Grind leaf tissue (approximately 1/4; w/v) in 0.1 M sodium phosphate buffer (pH 7.5), 

containing 5% (w/v) polyvinylpyrrolidone (PVP-40) and 0.12% (w/v) sodium sulphite 

(Na2SO3). A negative (inoculation buffer only) and a positive control must be included in 

each batch of inoculations. The positive control is a non-regulated virus which is 

moderately transmissible and produces clear symptoms on the herbaceous indicators, (e.g. 

Arabis mosaic virus). The plants must be inoculated in the following order: 

(a) inoculation buffer only; then 

(b) imported plants to be tested; then 

(c) positive control (non-regulated virus). 

3. Select two young fully expanded leaves preferably opposite leaves, to be inoculated on 

each plant and mark them by piercing holes with a pipette tip. 

4. Lightly dust the leaves with Celite or carborundum powder. Alternatively, a small 

amount of Celite or carborundum powder may be mixed with the sap extract. 

5. Using a gloved finger gently apply the sap to the marked leaves of the indicator plants, 

stroking from the petiole towards the leaf tip while supporting the leaf below with the 

other hand. 

6. After 3-5 minutes rinse inoculated leaves with water. 

7. Grow inoculated plants for a minimum of 4 weeks. Inspect and record plants twice per 

week for symptoms of virus infection. 

The Arabis mosaic virus positive control may be obtained from: 

1. ATCC Cat. No. PV-192, PV-589, PV-590 (http://www.atcc.org). 

2. DSMZ Cat. No. PV-0045, PV-0046, PV-0215, PV-0216, PV-0217, PV-0230, PV-0232 

(http://www.dsmz.de). 

3. The MPI (see the Contact Point, section 8) (available as freeze-dried leaf material or 

nucleic acid). A charge may be imposed to recover costs. 


The herbaceous indexing results will only be considered valid if: 

(a) no symptoms are produced on the indicator hosts with the negative control 

(inoculation buffer only); and 

(b) the correct symptoms are produced on the indicator hosts with the positive control 

(non-regulated virus). If Arabis mosaic virus was used as the positive control, the 

following symptoms will be produced on the herbaceous indicators: 

• C. quinoa – local lesions, and systemic chlorotic mottling. 


10

• N. benthamiana – not susceptible. 

• N. clevelandii – local lesions, systemic chlorotic spots, rings and lines. 

• N. tabacum – local lesions, systemic chlorotic spots, rings and lines. 

The virus symptoms produced on herbaceous indicators are described below. 

Sweetpotato yellow dwarf virus: 

• C. quinoa – susceptible, but no information is available on symptoms. 

Tobacco streak virus: 

• N. tabacum – systemic vein clearing, then downward curling of the leaf and its margins. 

7.1.3 Serological and molecular assays 

ELISA OR PCR MUST be carried out for the following viruses: 

• Sweetpotato vein mosaic virus 

• Tobacco streak virus 

ELISA OR PCR is OPTIONAL for the following virus: 

• Sweetpotato mild speckling virus 

PCR MUST be carried out for the following organisms: 

• Sweetpotato chlorotic stunt virus 

• Sweetpotato leaf curl virus 

• Sweetpotato little leaf phytoplasma 

PCR OR selective media MUST be carried out for the following bacterium: 

• Dickeya chrysanthemi 

7.1.3.1 Enzyme-linked immunosorbent assay (ELISA) 


1. Perform the ELISA according to the manufacturer’s instructions. The following controls 

must be included on each ELISA plate: 

(a) positive control: infected leaf tissue or equivalent (Table 2); and 

(b) negative control: sweetpotato tissue that is known to be healthy; and 

(c) buffer control: extraction buffer only. 

2. Add each of the samples and controls to the ELISA plate as duplicate wells. It is not 

recommended to perform ELISA with plant samples or sap that has been frozen. 

3. Measure the optical density 60 minutes after addition of the substrate (or as per 

manufacturer’s instructions). 


11

Table 2: Source of antisera and positive controls for ELISA 

Pathogen Antisera Positive/negative 

Sweetpotato vein mosaic virus 

and 

Sweetpotato mild speckling 

virus 


Agdia Cat No. PSA27200 (Potyvirus 

group: Pathoscreen kit) 1,2 

Tobacco streak virus Agdia Cat No. PSA25500 

(Pathoscreen kit) 1,2 

control 2 

Agdia Cat No. 

LNC 27200 

Agdia Cat No. 

LNP 27200 

Agdia Cat No. 

LPC25500 

1 

Catalogue numbers for the complete reagent sets are given, the antisera and reagents can 

also be purchased separately. 

2 

The positive control is included if the Pathoscreen set is purchased. 

Further information about the kits and the supplier listed in Table 2 can be found at the 

following website: 

• Agdia Incorporated, USA (http://www.agdia.com). 


A result is considered positive if the mean absorbance of the two replicate wells is greater 

than 2 times the mean absorbance of the negative control. The test will only be considered 

valid if: 

(a) the absorbance for the positive and negative controls are within the acceptable range 

specified by the manufacturer; and 

(b) the coefficient of variation (standard deviation / mean × 100), between the duplicate 

wells is less than 20%. 

If the test is invalid, it must be repeated with freshly-extracted sample. Samples that are close 

to the cut-off must be retested or tested using an alternative method recommended in the 

import health standard (see Table 1). 

7.1.3.2 Polymerase chain reaction (PCR) 

The following section describes the molecular tests required for regulated pests listed on the 

import health standard for I. batatas and I. setosa. The recommended published PCR primers 

for these tests are listed in Table 3 along with plant internal control primers for RNA and 

DNA. The inclusion of an internal control assay is recommended to eliminate the possibility 

of PCR false negatives due to extraction failure, nucleic acid degradation or the presence of 

PCR inhibitors. 

It is strongly recommended to extract nucleic acid from indicator plants (I. setosa or I. nil), 

3 to 5 weeks after grafting rather than extracting directly from I. batatas test plants. Viruses 

present in I. batatas can be unevenly distributed in the plant and virus titre can fluctuate over 

time. Virus levels in grafted indicator plants have been found to be higher in comparison 

with I. batatas (Kokkinos & Clark, 2006). 

The PCR reagents listed for the methods described in this section have been tested by the 

Plant Health & Environment Laboratory, MPI. Alternative reagents may give similar results 

but will require validation. 

12

Table 3: PCR primers used for the detection of regulated pests of I. batatas and I. setosa, 

and plant internal controls 

Target 

organism 

Bacterium 

Dickeya chrysanthemi 

(Use both assays to 

detect all pathovars) 

Phytoplasma 

Sweetpotato little leaf 

phytoplasma 

Viruses 

Sweetpotato chlorotic 

stunt virus 

(Use both assays to 

detect East & West 

African strains) 

Sweetpotato leaf curl 

virus 1 

Sweetpotato mild 

speckling virus and 

Sweetpotato vein 

mosaic virus 

Primer 

name 

ADE1 

ADE2 

recAF 

recAR 

P1 

P7 

R16F2 

R16R2 

Phyto-F 

Phyto-R 

Phyto-P 2 

SPCSV-F 

SPCSV-R 

SPCSV-P 2 

EASPCSV-38F 

EASPCSV-126R 

EASPCSV-67P 2 

SPG1 

SPG2 

SPLCV-F 

SPLCV-R 

SPLCV-P 2 

Oligo1n 

Oligo2n 

Tobacco streak virus IlarlF5 

IlarlR7 

Internal Control 

Plant DNA control Gd1 

Berg54 

Plant RNA control Nad5-s 

Nad5-as 

Plant NA control COX-F 

COX-R 

COX- P 2 


Sequence (5´-3´) TM 

(ºC) 

GATCAGAAAGCCCGCAGCCAGAT 

CTGTGGCCGATCAGGATGGTTTTGT 

CGTGC 

GGTAAAGGGTCTATCATGCG 

CCTTCACCATACATAATTTGGA 

AAGAGTTTGATCCTGGCTCAGGATT 

CGTCCTTCATCGGCTCTT 

ACGACTGCTAAGACTGG 

TGACGGGCGGTGTGTACAAACCCCG 

CGTACGCAAGTATGAAACTTAAAG 

GA 

TCTTCGAATTAAACAACATGATCCA 

FAM-TGACGGGACTCCGCACAAGCG 

-NFQ 3 

CGAATCAACGGATCGGAATT 

CCACCGACTATTACATCACCACTCT 

(MGB)FAM-ATCCCAACGTGTTTATCT 

A-NFQ 3 

GGAGTTTATTCCCACCTGTYTATCT 

GTAATTGCGAAGAATCYAAAACCT 

FAM-CGGCTACAGGCGACGTGGTTG 

TTG-NFQ 3 

ATCCVAAYWTYCAGGGAGCTAA 

CCCCKGTGCGWRAATCCAT 

GGCGCCTAAGTATGGCTGAA 

AACCGTATAAAGTATCTGGGAGT 

GGT 

(MGB)FAM-GTGGGACCCTTTGC- 

NFQ 3 

ATGGTHTGGTGYATHGARAAYGG 

TGCTGCKGCYTTCATYTG 

GCNGGWTGYGGDAARWCNAC 

AMDGGWAYYTGYTYNGTRTCACC 

ACGGAGAGTTTGATCCTG 

AAAGGAGGTGATCCAGCCGCACCTT 

C 

GATGCTTCTTGGGGCTTCTTGTT 

CTCCAGTCACCAACATTGGCATAA 

CGTCGCATTCCAGATTATCCA 

CAACTACGGATATATAAGAGCCAA 

AACTG 

FAM-TGCTTACGCTGGATGGAATG 

CCCT- NFQ 3 

Band 

(bp) 

Reference 

72 420 Nassar et al., 

1996 

47 760 Waleron et al., 

2002 

53 1800 Deng & Hiruki, 

1991; 

Schneider et al., 

1995 

50 1248 Lee et al., 1993 

60 75 Christensen et 

al., 2004 

60 71 Kokkinos & 

Clark, 2006 

60 90 N. Boonham 

(Unpublished) 

58 934 Li et al., 2004 

66 60 Kokkinos & 

Clark, 2006 

50 327 Marie-Jeanne et 

al., 2000 

48 300 Untiveros et al., 

2010 

50-62 1500 Andersen et al., 

1998 

50-60 180 Menzel et al., 

2002 

60 74 Weller et al., 

2000 

1 Single stranded DNA virus; 2 Real-time probe; 3 NFQ = Non-fluorescent quencher. 

13

7.1.3.2.1 Virus reverse transcription-PCR 

Recommended method for RNA viruses: conventional RT-PCR 

1. Extract total RNA from leaf tissue according to a standard protocol. Successful RT-PCR 

amplification can be achieved using the following RNA extraction procedures: 

(a) Qiagen RNeasy ® Plant Mini Kit (Qiagen Cat. No. 74904); or 

(b) a silica-based method as described by Menzel et al. (2002); or 

(c) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL 

workstation. 

Commercial kits are used as described by the manufacturer. See Appendix 3 for details 

of other extraction methods. Alternative methods may also be used after validation. 

2. Optional: Perform a one-step RT-PCR on the RNA with the Nad5 internal control 

primers (Table 3) using the components and concentrations listed in Table 4 and cycle 

under the conditions listed in Table 6. The Nad5 primers amplify mRNA from plant 

mitochondria. 

3. Perform a one-step RT-PCR on the RNA with the pathogen-specific primers (Table 3) 

using the components and concentrations listed in Table 4 and cycle under the conditions 

listed in Table 6. The following controls must be included for each set of RT-PCR 

reactions: 

(a) positive control: RNA extracted from virus-infected leaf tissue or equivalent; and 

(b) no template control: water is added instead of RNA template. 

When setting up the test initially, it is advised that a negative control (RNA extracted 

from healthy Ipomoea leaf tissue) is included. Please note that the Nad5 internal control 

primers do not reliably amplify a product from RNA extracted from freeze-dried material. 

We therefore recommend mixing fresh healthy Ipomoea leaf material with freeze-dried 

positive control material (3:1 w/w) prior to carrying out the extraction. 

4. Analyse the PCR products by agarose gel electrophoresis. 

Recommended method for DNA viruses: conventional PCR 

1. Extract total DNA from leaf tissue according to a standard protocol. Successful PCR 

amplification can be achieved using 

(a) Qiagen DNeasy ® Plant Mini Kit (Qiagen Cat. No. 69104); or 

(b) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL 

workstation. 

Commercial kits are used as described by the manufacturer. Alternative methods may 

also be used after validation. 

2. Optional: Perform a PCR on the DNA with the Gd1/Berg54 internal control primers 

(Table 3) using the components and concentrations listed in Table 5 and cycle under the 

conditions listed in Table 6. The Gd1/Berg54 primers amplify the 16S rRNA gene from 

most prokaryotes as well as from chloroplasts. 

3. Perform a PCR on the DNA with the pathogen-specific primers (Table 3) using the 

components and concentrations listed in Table 5 and cycle under the conditions listed in 

Table 6. The following controls must be included for each set of PCR reactions: 

(a) positive control: DNA extracted from virus-infected leaf tissue or equivalent; and 

(b) no template control: water is added instead of DNA template. 

When setting up the test initially, it is advised that a negative control (DNA extracted 

from healthy Ipomoea leaf tissue) is included. 



14

Interpretation of results for conventional (RT) PCR 

The RT-PCR or PCR test will only be considered valid if: 

(a) the positive control produces the correct size product as indicated in Table 3; and 

(b) no bands are produced in the negative control (if used) and the no template control. 

If the Nad5 or Gd1/Berg54 internal control primers are also used, then the negative control (if 

used), positive control and each of the test samples must produce a 181 bp (Nad5) or 1500 bp 

(Gd1/Berg54) band. Failure of the samples to amplify with the internal control primers 

suggests that the nucleic acid extraction has failed or compounds inhibitory to PCR are 

present in the nucleic acid extract, or the nucleic acid has degraded. 

Table 4: RT-PCR reaction components for RNA templates using Invitrogen 

SuperScript ® III One-step RT-PCR System with Platinum ® Taq DNA polymerase 

Reagent Volume per reaction (µl) 

Nuclease-free water 4.2 

10 × Reaction mix (Invitrogen 12574-026) 10.0 

5 µM Forward primer (250 nM) 1.0 

5 µM Reverse primer (250 nM) 1.0 

SuperScript ® III/ RT/ Platinum ® Taq Mix 0.8 

10 mg/ml Bovine Serum Albumin (BSA) (Sigma A7888) 1.0 

RNA template 2.0 

Total volume 20.0 

Table 5: PCR reaction components for DNA templates using 

Promega GoTaq ® Green Master Mix 



GoTaq ® Green Master Mix (Promega M7122) 10.0 

50 mM MgSO4 (4 mM final)* 1.0* 



10 mg/ml Bovine Serum Albumin (BSA) (Sigma A7888) 1.0 

DNA template 2.0 


*Li et al. (2004) PCR only, for all other primers, adjust water volume accordingly 

Table 6: Generic PCR cycling conditions 

Step Temperature Time No. of cycles 

RT step only 50 o C 30 min 1 

Initial denaturation 94 o C 2 min 1 

Denaturation 94 o C 30 sec 

Annealing See Table 3 30 sec 

Elongation 72 

40 

o C 

30 to 45 sec (virus/bacteria) 

1 min (phytoplasma) 

Final elongation 72 o C 7 min 1 


15

Recommended method for RNA viruses: real-time RT-PCR 

1. Extract total RNA from leaf tissue according to a standard protocol (as described above). 

2. Set-up a one-step RT-PCR using pathogen-specific primers (Table 3) and the components 

and concentrations listed in Table 7 and cycle under the conditions listed in Table 8. 

Please note that reaction and cycling conditions can be changed depending on the realtime 

machine used, but this would require validation. 

3. Optional: Perform a one-step RT-PCR on the nucleic acid using the COX internal control 

primers (Table 3) and the components and concentrations listed in Table 7 and cycle 

under the conditions listed in Table 8. The COX primers amplify the constitutive 

cytochrome oxidase 1 gene found in plant mitochondria (note: this assay is not RNA 

specific). 

4. The following controls must be included for each set of reactions: 

(a) positive control: RNA extracted from virus-infected leaf tissue or equivalent; and 

(b) no template control: water is added instead of RNA template. 

5. When setting up the test initially, it is advised that a negative control (RNA extracted 


6. Analyse real-time amplification data according to the manufacturer’s instructions 

accompanying the real-time PCR machine. 

Recommended method for DNA viruses: real-time PCR 

1. Extract total DNA from leaf tissue according to a standard protocol (as described above). 

2. Set-up the PCR using pathogen-specific primers (Table 3) and the components and 

concentrations listed in Table 9 and cycle under the conditions listed in Table 10. Please 

note that reaction and cycling conditions can be changed depending on the real-time 

machine used, but this would require validation. 

3. Optional: Perform PCR on the nucleic acid using the COX internal control primers 

(Table 3), and using the components and concentrations listed in Table 9 and cycle under 

the conditions listed in Table 10. 


(a) positive control: DNA extracted from virus-infected leaf tissue or equivalent; and 

(b) no template control: water is added instead of DNA template 

5. When setting up the test initially, it is advised that a negative control (DNA extracted 


6. Analyse real-time amplifcation data according to the manufacturer’s instructions 

accompanying the real-time PCR machine. 

Table 7: Real-time RT-PCR reaction components for RNA templates using 

Invitrogen Superscript ® III One-step qRT PCR system 



2 × Reaction Mix (Invitrogen 11730-017) 10.0 

10 µg/µl Bovine Serum Albumin (BSA) (Sigma A7888) 0.5 



5 µM Dual-labelled fluorogenic probe (100 nM) 0.4 

Superscript ® III RT/Platinum ® Taq Mix 0.4 

RNA 2.0 



16

Table 8: Generic cycling conditions for RNA real-time RT-PCR 


RT-Step 50ºC 30 min 1 


Denaturation 95 o C 10 sec 40 

Annealing & elongation See Table 3 40 sec 

Table 9: Real-time PCR reaction componnets for DNA templates using 

Invitrogen Platinum ® qPCR SuperMix-UDG 



Platinum ® Quantitative PCR Supermix-UDG (Invitrogen 11730-017) 10.0 





DNA 2.0 


Table 10: Generic cycling conditions for DNA real-time PCR 


UDG incubation hold 

(Invitrogen only) 

50ºC 2 min 1 

Initial denaturation 95ºC 2 min (Invitrogen) 

5 min (Roche) 

1 

Denaturation 95ºC 10 sec 40 

Annealing & elongation See Table 3 40 sec 

Interpretation of results for real-time PCR 

The real-time PCR or RT-PCR test will only be considered valid if: 

(a) the positive control produces an amplification curve with the pathogen-specific 

primers; and 

(b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the negative 

control (if used) and the no template control. 

If the COX internal control primers are also used, then the negative control (if used), positive 

control and each of the test samples must produce an amplification curve. Failure of the 

samples to produce an amplification plot with the internal control primers suggests that the 

nucleic acid extraction has failed or compounds inhibitory to PCR are present in the nucleic 

acid extract, or the nucleic acid has degraded. 

Virus positive controls for PCR 

Tobacco streak virus positive control controls may be obtained from the following sources: 

1. American Type Culture Collection (ATCC; http://www.atcc.org): No. PV-276, PV-31, 

PV-352, PV-353, PV-360. 

2. DSMZ Culture Collection (http://www.dsmz.de): PV-0309, PV-0612, PV-0738. 

3. The commercial source listed in Table 2. 


17

Positive control material, in the form of nucleic acid, for Sweetpotato chlorotic stunt virus 

and Sweetpotato leaf curl virus and Tobacco streak virus may be obtained from MPI (see the 

Contact Point, section 8). Positive control material for Sweetpotato vein mosaic virus and 

Sweetpotato mild speckling virus is currently unobtainable; however, an alternative Potyvirus 

may be used for the PCR. Potyvirus positive controls in the form of nucleic acid may also be 

obtained from the MPI. A charge may be imposed to recover costs. 

7.1.3.2.1.1 Sweet potato chlorotic stunt virus 

Plants must be tested for Sweetpotato chlorotic stunt virus by real-time PCR using the primer 

pairs listed in Table 3. See section 7.1.3.2.1 for details of test methods and interpretation of 

results. Please note that SPCSV should be tested with both sets of primers listed in Table 3 in 

order to detect both East and West African strains. 

7.1.3.2.1.2 Sweetpotato leaf curl virus 

Plants must be tested for Sweetpotato leaf curl virus by PCR or real-time PCR using the 

primer pairs listed in Table 3. See section 7.1.3.2.1 for details of test methods and 

interpretation of results. Please note the Li et al., (2004) PCR should be cycled as shown in 

Table 11 

Table 11: Cycling conditions for SPLCV PCR 

Step Temperature Time No. of Cycles 


Denaturation 94 o C 30 sec 

Annealing 58ºC 30 sec 

40 

Elongation 68 o C 90 sec 


7.1.3.2.1.3 Sweetpotato mild speckling virus 

Plants can be tested for Sweetpotato mild speckling virus by RT-PCR using the primer pairs 

listed in Table 3. Please note that a suitable positive control is not available for Sweetpotato 

mild speckling virus, however, the PCR has been validated with other potyviruses. See 

section 7.1.3.2.1 for details of test methods and interpretation of results. 

7.1.3.2.1.4 Sweetpotato vein mosaic virus 

Plants must be tested for Sweetpotato vein mosaic virus by RT-PCR using the primer pairs 

listed in Table 3. Please note that a suitable positive control is not available for Sweetpotato 

vein mosaic virus, however, the PCR has been validated with other potyviruses. See section 

7.1.3.2.1 for details of test methods and interpretation of results. 

7.1.3.2.1.5 Tobacco streak virus 

Plants must be tested for Tobacco streak virus by RT-PCR using the primer pair listed in 

Table 3. See section 7.1.3.2.1 for details of test methods and interpretation of results. 


18

7.1.3.2.2 Phytoplasma PCR 

Recommended method phytoplasma: conventional PCR 

1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol. 

Successful PCR amplification can be achieved using the following DNA extraction 

procedures: 


(b) phytoplasma enrichment procedure as described by Kirkpatrick et al. (1987) and 

modified by Ahrens & Seemüller (1992); or 

(c) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL 

workstation. 

Commercial kits are used as described by the manufacturer. See Appendix 3 for details 

of other extraction methods. Alternative methods may also be used after validation. 

2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers (Table 3) using 

the components and concentrations listed in Table 5 (section 7.1.3.2.1) and cycle under 

the conditions listed in Table 6 (section 7.1.3.2.1). The Gd1/Berg54 primers amplify the 

16S rRNA gene from most prokaryotes as well as from chloroplasts. 

3. Perform a nested PCR on the purified DNA using the universal phytoplasma primer pair 

P1/P7 (Table 3), for the first-stage PCR, followed by the R16F2/R16R2 primer pair 

(Table 3) for the second-stage PCR. 

4. Set-up the first-stage and second-stage PCR reactions using the components and 

concentrations listed in Table 5 (section 7.1.3.2.1) and cycle under the conditions listed in 

Table 6 (section 7.1.3.2.1). The first-stage PCR products are diluted 1:25 (v/v) in water 

prior to re-amplification using the second-stage PCR primers. 

5. The following controls must be included for each set of PCR reactions: 

(a) positive control: total DNA or a cloned fragment from the appropriate organism may 

be used. If the internal control primers are not used, then the DNA must be mixed 

with healthy Ipomoea DNA to rule out the presence of PCR inhibitors; and 




6. Analyse the PCR products (second-stage PCR products only) by agarose gel 

electrophoresis. 


The pathogen-specific PCR test will only be considered valid if: 



If the Gd1/Berg54 internal control primers are also used, then the negative control (if used), 

positive control and each of the test samples must produce a 1500 bp band. Failure of the 

samples to amplify with the control primers suggests that either the DNA extraction has 

failed or compounds inhibitory to PCR are present in the DNA or the DNA has degraded. An 

effective method to further purify the DNA is by using MicroSpin S-300 HR columns (GE 

Healthcare Cat. No. 27-5130-01). 

Recommended method for phytoplasma: Real-time PCR 

1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol (as 

described above). 

2. Set-up the real-time PCR using pathogen-specific primers (Table 3) and the components 

and concentrations listed in Table 12 and cycle under the conditions listed in Table 10. 


19

The reaction and cycling conditions can be changed depending on the real-time reagents 

and machine used, but this would require validation. 

3. Optional: Perform PCR on the nucleic acid using the COX internal control primers 

(Table 3), and using the components and concentrations listed in Table 12 and cycle 

under the conditions listed in Table 10. 


(a) Positive control: total DNA or a cloned fragment from the appropriate organism 

may be used. If the internal control primers are not used, then the DNA must be 

mixed with healthy Ipomoea DNA to rule out the presence of PCR inhibitors; and 

(b) no template control: water is added instead of DNA template 

5. When setting up the test initially, it is advised that a negative control (DNA extracted 


6. Analyse real-time amplification data according to the real-time thermocycler 

manufacturer’s instructions. 

Table 12: Real-time PCR reaction components for phytoplasma using 

Roche LightCycler 480 Probes Mastermix 



2 × Reaction Mix (Roche 04707494001) 10.0 





DNA 2.0 


Interpretation of results for real-time PCR 

The real-time PCR test will only be considered valid if: 

(a) the positive control produces an amplification curve with the pathogen-specific 

primers; and 

(b) no amplification curve is seen (i.e. cycle threshold [CT] value is 40) with the negative 

control (if used) and the no template control. 

If the COX internal control primers are also used, then the negative control (if used), positive 

control and each of the test samples must produce an amplification curve. Failure of the 

samples to produce an amplification plot with the internal control primers suggests that the 

DNA extraction has failed or compounds inhibitory to PCR are present in the DNA extract or 

the DNA has degraded. The effect of inhibitors may be overcome by adding Bovine Serum 

Albumin (BSA) to a final concentration of 0.5µg/µl. Alternatively, DNA may be further 

purified using MicroSpin S-300 HR columns (GE Healthcare Cat. No. 27-5130-01). 

Phytoplasma positive controls for PCR 

Positive control material for Sweetpotato little leaf phytoplasma (available as DNA) may be 

obtained from MPI (see the Contact Point, section 8). A charge may be imposed to recover 

costs. 


20

7.1.3.2.2.2 Sweetpotato little leaf phytoplasma 

Plants must be tested for Sweetpotato little leaf phytoplasma using the universal primers 

listed in Table 3. See section 7.1.3.2.2 for details of test methods and interpretation of 

results. 

7.1.3.2.3 Bacteria PCR 

Recommended method bacteria: conventional PCR 

1. Extract total DNA from leaf petioles and mid-veins according to a standard protocol. 

Successful PCR amplification can be achieved using the following DNA extraction 

procedures: 


(b) InviMag® Plant Mini Kit (Invitek Cat. No. 243711300) used in a Kingfisher mL 

workstation. 

2. Optional: Perform a PCR with the Gd1/Berg54 internal control primers listed in Table 3 

using the components and concentrations listed in Table 5 and cycled as shown in table 6. 

3. Perform a PCR with bacteria-specific primers on the purified DNA using the components 

and concentrations listed in Table 5. See Table 13, section 7.1.3.2.3.1 for details of PCR 

cycling conditions. The following controls must be included for each set of PCR 

reactions: 

(a) positive control: total DNA or a cloned fragment from the appropriate organism may 

be used. If the internal control primers are not used, then the DNA must be mixed 

with healthy Ipomoea DNA to rule out the presence of PCR inhibitors; 



from healthy Ipomoea tissue) is included. 



The pathogen-specific PCR test will only be considered valid if: 



If the Gd1/Berg54 internal control primers are also used, then the negative control (if used), 

positive control and each of the test samples must produce a 1500 bp band. Failure of the 

samples to amplify with the control primers suggests that either the DNA extraction has 

failed or compounds inhibitory to PCR are present in the DNA or the DNA has degraded. An 

effective method to further purify the DNA is by using MicroSpin S-300 HR columns (GE 

Healthcare Cat. No. 27-5130-01). 

Bacterial positive controls for PCR 

Positive control material for Dickeya chrysanthemi (available as DNA) may be obtained from 

MPI (see the Contact Point, section 8). A charge may be imposed to recover costs. 

7.1.3.2.3.1 Dickeya chrysanthemi 

Plants must be tested for Dickeya chrysanthemi using the primer pairs ADE1/ADE2 and 

recAF/recAR (Table 3). See section 7.1.3.2.3 for details of test methods and interpretation of 

results. Please note that PCRs are cycled as shown in Tables 13 and 14. 


21

(a) Primers recAF/recAR (Waleron et al., 2002) detects bacteria at the generic level belonging 

to the former Erwinia genus; however, sequencing of the resulting recA PCR product will 

provide resolution to the sub-species level. 

(b) Primers ADE1/ADE2 (Nassar et al., 1996) will detect pectinolytic strains of Dickeya 

spp. 

Table 13: Cycling conditions for Waleron et al., 2002 PCR 



Denaturation 94 o C 1 min 

Annealing 47ºC 1 min 

35 

Elongation 72 o C 2 min 


Table 14: Cycling conditions for Nassar et al., 1996 PCR 



Denaturation 94 o C 1 min 

Annealing 72ºC 1 min 

25 

Elongation 72 o C 2 min 


7.1.4 Bacterial isolation on media 

Isolation of regulated bacteria from plants is a required test on the Ipomoea IHS. Plants 

should be tested separately. Aseptic techniques should be used throughout the test procedure. 

7.1.4.1 Dickeya chrysanthemi (basonym. Erwinia chrysanthemi) 

Dickeya chrysanthemi primarily occurs on storage roots but the bacteria can also move into 

the vascular tissues of the aerial parts of the plant and become systemic. For testing the aerial 

parts of sweetpotato plants, leaf petioles and mid-veins (vascular strands) should be tested in 

summer or under summer-like conditions. At least two fully expanded leaves must be 

sampled from the indicator plant, one young leaf from the top of the plant and one older leaf 

from a mid-way position. Leaves should be tested as soon as possible after removal from the 

plant. 


Macerate a small amount of tissue in 500 µl of sterile distilled water. Pipette 100 µl of 

macerate into 5 ml of PT (pectate tergitol) broth and incubate anaerobically at 27°C for 48 h. 

Undiluted broth (100 µl) and a 10-fold serial dilution of broth are spread onto crystal violet 

pectate agar plates and incubated at 27°C for 3 days. Suspected pectolytic Dickeya can be 

transferred to Potato Dextrose Agar (PDA) and colony morphology examined. 


D. chrysanthemi bacteria are mottled, gram-negative, non-sporing, straight rods with rounded 

ends. The bacteria can occur as single cells or in pairs. The average cell size is 1.8 × 0.6 µm 


22

and the average number of peritichous flagellae is 8-11. On PDA media, depending on the 

moisture content, young colonies can be circular, convex, smooth and entire, or sculptured 

with irregular margins. After 4-5 days, both types of colonies resemble a fried egg, with a 

pinkish, round, raised centre and a lobed periphery, which later becomes feathery. 

7.1.5 Microscopic inspection for mites 

Microscopic examination of plants for regulated mites is a required test on the Ipomoea IHS. 

7.1.5.1 Tetranychus evansi 


For each plant, use a hand lens to inspect the underside of all leaves for mite eggs, nymphs, 

adults and symptoms of mite presence. Following this, for each plant, the 3 youngest leaves 

of each plant plus any suspect leaves showing the presence of mites must be collected for 

further examination using a binocular microscope. For species identification, both male and 

female mites must be collected. Male mites should be mounted laterally onto a microscope 

slide and female mites should be mounted dorsally to expose the diagnostic characters. To 

improve transparency, the mites can be cleared in lactic acid under a table lamp prior to 

mounting. 


If mites are present the following symptoms may be observed on the underside of leaves; 

webbing, distinct small yellow spots (which get larger over time), leaf browning and in 

extreme cases the leaves may shrivel up and die. Overall, plant vigour and growth may be 

affected (Fig. 1.4). 

Mites of the Tetranychus genus can be green, yellow, orange or red in colour. Adult males 

are smaller than the females for all Tetranychus spp. T. evansi female mites are reddish in 

colour and the males are straw-coloured with a more pointed abdomen (Fig. 1.3). 

Species level identification requires examination of the male aedeagus (i.e. the male 

genitalia). For T. evansi, the male adeagus will appear upright at a 90ºC angle. 


23

8. CONTACT POINT 

This manual was developed by: 

Dr Lisa Ward 

Plant Health & Environment Laboratory, 

Investigation and Diagnostic Centres and Response, 

Ministry for Primary Industries (MPI), 

231 Morrin Road, 

St Johns, 

PO Box 2095, 

Auckland 1140 

Tel: +64 9 909 3015 

Fax: +64 9 909 5739 

Email: peqtesting@mpi.govt.nz 

Website: http://www.biosecurity.govt.nz/regs/imports/plants/high-value-crops 

9. ACKNOWLEDGEMENTS 

We would like to acknowledge the following people who contributed to the preparation of 

this manual: 

• Mr John Fletcher (The New Zealand Institute for Plant & Food Research Ltd, Lincoln, 

New Zealand) for drafting the introduction and propagation sections of the manual, for 

valuable discussion and advice on sweetpotato viruses, and for providing photographs of 

virus-infected sweetpotato. 

• Dr Chris Clark and Ms Mary Hoy (Louisiana State University, USA) for valuable 

discussion on sweetpotato viruses, for supplying isolates of SPV2 and SPLCV, and for 

supplying several photographs of virus-infected I. batatas and I. setosa. 

• Dr Steve Lewthwaite (The New Zealand Institute for Plant & Food Research Ltd, 

Pukekohe, New Zealand) for providing the front cover image of the sweetpotato cultivar 

'Radical' (the first New Zealand sweetpotato cultivar to receive plant variety rights) and 

for providing information on seed propagation. 

• Dr Segundo Fuentes (International Potato Centre (CIP), Peru) for valuable discussion on 

sweetpotato viruses. 

• Ms Susan Sim (Foundation Plant Services, University of California, Davis, USA) for 

valuable advice on graft inoculation. 

• Dr Karen Gibb (Charles Darwin University, Australia) for supplying phytoplasma DNA 

and the photograph of the Sweetpotato little leaf phytoplasma. 

• The American Phytopathological Society (APS) for permission to use images from the 

Diseases of Root and Tuber Crops CD-Rom, 2000, St Paul, MN, USA. 

10. REFERENCES 

Ahrens, U; Seemüller, E (1992) Detection of DNA of plant pathogenic mycoplasma-like 

organisms by a polymerase chain reaction that amplifies a sequence of the 16S rRNA gene. 

Phytopathology 82: 828-832. 


24

Andersen, M T; Beever, R E; Gilman, A C; Liefting, L W; Balmori, E; Beck, D L; 

Sutherland, P W; Bryan, G T; Gardner, R C Forster, R L S (1998) Detection of Phormium 

yellow leaf phytoplasma in New Zealand flax (Phormium tenax) using nested PCRs. Plant 

Pathology 47: 188-196. 

Chen, J; Chen, J; Adams, M J (2001) A universal PCR primer to detect members of the 

Potyviridae, and its use to examine the taxonomic status of several members of the family. 

Archives of Virology 146: 757-766. 

Christensen, N M; Nicolaisen, M; Hansen, M; Schulz, A (2004) Distribution of phytoplasmas 

in infected plants as revealed by real-time PCR and bioimaging. Molecular Plant Microbe 

Interactions 17: 1175-1184. 

Clark, C A; Moyer, J W (1988) Compendium of sweetpotato diseases. The American 

Phytopathological Society Press. 

Deng, S; Hiruki, D (1991) Amplification of 16S rRNA genes from culturable and 

nonculturable mollicutes. Journal of Microbiological Methods 14: 53-61. 

Fletcher, J D; Lewthwaite, S L; Fletcher, P J; Dannock, J (2000) Sweetpotato (Kumara) virus 

disease surveys in New Zealand. International Workshop on Sweetpotato Cultivar Decline 

Study, Miyakonojo, Japan. 

Kirkpatrick, B C; Stenger, D C; Morris, T J; Purcell, A H (1987) Cloning and detection of 

DNA from a nonculturable plant pathogenic mycoplasma-like organism. Science 238: 197- 

200. 

Kokkinos, C D; Clark, C A (2006) Real-time PCR assays for detection and quantification of 

sweetpotato viruses. Plant Disease 90:783-788. 

Lee, I M; Hammond, R W; Davis, R E; Gundersen, D E (1993) Universal amplification and 

analysis of pathogen 16S rDNA for classification and identification of mycoplasmalike 

organisms. Phytopathology 83: 834-842. 

Lewthwaite, S L (1997) Commercial sweetpotato production in New Zealand: foundations 

for the future. In: Proceedings of the International Workshop on Sweetpotato production 

System toward the 21st Century, Miyakonojo, Miyazaki, Japan, (eds, D R La Bonte; 

Yamashita, M; Mochida, H), Kyushu National Agricultural Experiment Station, Japan. p. 33- 

50. 

Li, R; Salih, S; Hurtt, S (2004) Detection of geminiviruses in sweetpotato by polymerase 

chain reaction. Plant Disease 88: 1347-1351. 

Marie-Jeanne, V; Ioos, R; Peyre, J; Alliot, B; Signoret, P (2000) Differentiation of Poaceae 

Potyviruses by reverse transcription-polymerase chain reaction and restriction analysis. 

Journal of Phytopthaology 148: 141-151. 

Menzel, W; Jelkmann, W; Maiss, E (2002) Detection of four apple viruses by multiplex RT- 

PCR assays with coamplification of plant mRNA as internal control. Journal of Virological 

Methods 99: 81-92. 


25

Nassar, A; Darrasse, A; Lemattre, M; Kotoujansky, M;. Dervin, A; Vedel, R; Bertheau, Y 

(1996) Characterisation of Erwinia chrysanthemi by pectinolytic isozyme polymorphism and 

restriction fragment length polymorphism analysis of PCR-amplification fragments of pel 

genes. Applied and Environmental Microbiology 62: 2228-2235. 

Saladaga, F A; Takagi, H; Cherng, S J; Opena, R T (1991) Handling and selecting improved 

clones from true seed populations of sweetpotato. Asian Vegetable Research and 

Development Centre International Cooperator’ Guide 91: 384. 

Schneider, B; Seemüller, E; Smart, C D; Kirkpatrick, B C (1995) Phylogenetic classification 

of plant pathogenic mycoplasma-like organisms or phytoplasmas. In Razin, S & Tully, J G 

(eds) Molecular and Diagnostic Procedures in Mycoplasmology, Vol. 1. Academic Press, 

San Diego, CA; p. 369-380. 

Univertos, M; Perez-Egusquiza, Z; Clover, G R (2010) PCR assays for the detection of 

members of the genus Ilarvirus and family Bromoviridae. Journal of Virological Methods 

165: 97-104 

Waleron, M; Waleron, K; Podhajska, A.J; Kojkowska, E (2002) Genotyping of bacteria 

belonging to the former Erwinia genus by PCR-RFLP analysis of a recA gene fragment. 

Microbiology 148: 583-595. 

Weller, S A; Elphinstone, J G; Smith, N C; Boonham, N; Stead, D E (2000) Detection of 

Ralstonia solanacearum strains with a quantitative multiplex real-time, fluorogenic PCR 

(TaqMan) assay. Applied and Environmental Microbiology 66: 2853-2858. 


26

Appendix 1. Symptoms of significant regulated pests of Ipomoea batatas 

1.1 Meliodogyne incognita 

(a) (b) 

(a) Galls and egg masses produced by M. incognita on fibrous roots; (b) cracking of fleshy storage roots 

associated with injury by M. incognita. (Courtesy W.J. Martin (a) & G.W. Lawrence (b) reproduced with 

permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA). 

1.2 Rotylenchulus reniformis 

Cracking of fleshy storage roots associated with injury by R. reniformis (Courtesy C.A. Clark reproduced with 

permission from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA). 

1.3 Tetranychus evansi 

T. evansi mites, male (left) and female (right). 

(Courtesy EcoPort http://www.ecoport.org 

: image 13039, E.A. Ueckerman). 


1.4 Plant damage caused by mites 

Plant damage caused by feeding Tetranychus 

evansi (Courtesy EcoPort http://www.ecoport.org 

: image 13043, ARC-PPRI) 

27

. 

1.5 Streptomyces ipomoea 

(a) (b) 

(a) Soil pox lesions caused by S. ipomoea on storage roots of I. batatas clone L4-89 (b) I. batatas rootlet rot on 

sweetpotato fibrous roots, caused by S. ipomoea. (Courtesy W.J. Martin (a) & (b) reproduced with permission 

from the Diseases of Root and Tuber Crops CD-ROM, 2002, APS, St Paul, MN, USA). 

1.6 Elsinoë batatas 

Petiole and stem lesions on I. batatas caused by 

Elsinoë batatas. (Courtesy R. Gapsin reproduced 

with permission from the Diseases of Root and 

Tuber Crops CD-ROM, 2002, APS, St Paul, MN, 

USA). 


1.7 Dickeya chrysanthemi 

Bacterial rot on I. batatas ‘Jewel’ storage root 

caused by Dickeya chrysanthemi. (Courtesy C. A. 

Clark reproduced with permission from the 

Diseases of Root and Tuber Crops CD-ROM, 2002, 

APS, St Paul, MN, USA). 

28

1.8 Ipomoea batatas infected with a mixture of viruses 

Leaf symptoms on I. batatas ‘Toka Toka Gold’ infected with Sweetpotato feathery mottle virus, Sweetpotato 

chlorotic fleck virus, and Sweetpotato virus C6. (Courtesy J. Fletcher, The New Zealand Institute for Plant & 

Food Research Ltd, Lincoln, New Zealand). 

1.9 Sweetpotato chlorotic stunt virus 

Interveinal purpling on Regal sweetpotato infected 

with the ‘White Bunch’ or ‘US’ strain of 

Sweetpotato chlorotic stunt virus (Courtesy C. 

Clark, Louisiana State University., USA). 

1.11 Sweetpotato little leaf phytoplasma 


1.10 Sweetpotato leaf curl virus 

Sweetpotato leaf curl virus symptoms in plant bed 

on sweetpotato line W-359 (Courtesy C. Clark, 

Louisiana State University, USA). 

Sweetpotato little leaf phytoplasma infecting I. 

batatas ‘LO323’. (Courtesy K. Gibb, Charles 

Darwin University, Australia). 

29

Appendix 2. Virus symptoms on graft inoculated Ipomoea setosa 

2.1 Sweetpotato chlorotic stunt virus + 

Sweetpotato feathery mottle virus 

Symptoms on Ipomoea setosa inoculated with the 

‘White Bunch’ or ‘US’ strain of Sweetpotato 

chlorotic stunt virus and the russet crack strain of 

Sweetpotato feathery mottle virus (Courtesy C. 

Clark, Louisiana State University, USA). 

2.3 Sweetpotato virus C6 


2.2 Sweetpotato virus 2 

Symptoms induced in Ipomoea setosa by C6 virus 

(Courtesy C. Clark, Louisiana State University, USA). 

Initial symptoms of Sweetpotato virus 2 in Ipomoea 

setosa (Courtesy C. Clark, Louisiana State 

University, USA). 

30

2.4 Sweetpotato leaf curl virus 

Ipomoea setosa infected with SWFT-1 showing leaf 

curling (Courtesy C. Clark, Louisiana State University, 

USA). 


2.5 Sweetpotato leaf curl virus + Sweetpotato 

virus 2 

Ipomoea setosa infected with SPLCV (SWFT-1) and 

SPV-2 (LSU-2) showing prominent leaf curling 


2.6 Sweetpotato leaf curl virus + Sweetpotato feathery mottle virus 

Ipomoea setosa showing leaf rolling, chlorosis and 

interveinal necrosis after being grafted with a sweetpotato, infected 

with SPLCV and SPFMV-Russet Crack 


31

Appendix 3. Protocols referenced in manual 

3.1 Silica-milk RNA extraction protocol (Menzel et al., 2002) 

1. Grind 0.2-0.5 g leaf tissue (1/10; w/v) in RNA extraction buffer (6 M guanidine 

hydrochloride, 0.2 M sodium acetate, 25 mM EDTA, 2.5% [w/v] PVP-40 adjusted to pH 5 

with acetic acid). 

2. Transfer 500 µl of the homogenised extract to a micro-centrifuge tube containing 100 µl of 

10% (w/v) SDS. 

3. Incubate at 70 o C for 10 minutes with intermittent shaking, and then place on ice for 5 

minutes. 

4. Centrifuge at 13,000 rpm for 10 minutes. 

5. Transfer 300 µl supernatant to a new micro-centrifuge tube and add 300 µl high salt buffer 

(6 M sodium iodide, 0.15 M sodium sulphite), 150 µl absolute ethanol and 25 µl silica milk 

(1 g/ml silicon dioxide, 1-5 µM size particles, suspended in 100 mM glycine, 100 mM NaCl, 

100 mM HCl, pH 2). 

6. Incubate at room temperature for 10 minutes with intermittent shaking. 

7. Centrifuge at 3,000 rpm for 1 minute and discard the supernatant. 

8. Resuspend the pellet in 500 µl of wash buffer (10 mM Tris-HCl pH 7.5, 0.05 mM EDTA, 50 

mM NaCl, 50% [v/v] absolute ethanol), centrifuge at 3,000 rpm for 1 minute and discard the 

supernatant. Repeat this wash step. 

9. Centrifuge at 3,000 rpm for 1 minute and remove any remaining wash buffer from the pellet. 

10. Resuspend the pellet in TE buffer (10mM Tris-HCl pH 7.5, 0.05 mM EDTA). 

11. Incubate at 70 o C for 4 minutes then centrifuge at 13,000 rpm for 5 minutes. 

12. Transfer 100 µl of the supernatant to a sterile nuclease-free micro-centrifuge tube, being 

careful not to disturb the pellet. Store at -80 o C. 

3.2 Phytoplasma DNA enrichment CTAB extraction protocol (Kirkpatrick et al., 1987 and 

modified by Ahrens & Seemüller, 1992) 

1. Grind approximately 0.3 g tissue (petioles, veins) in 3 ml ice-cold isolation buffer (0.1 M 

Na2HPO4, 0.03 M NaH2PO4, 10 mM EDTA (pH 8.0), 10% (w/v) sucrose, 2% (w/v) PVP-40; 

Adjust pH to 7.6 and filter sterilise. Just prior to use add 0.15% (w/v) Bovine Serum 

Albumin (BSA) and 1 mM ascorbic acid). 

2. Transfer crude sap to a cold 2 ml micro-centrifuge tube. 

3. Centrifuge at 4ºC for 5 min at 4500 rpm. 

4. Transfer supernatant into a clean 2 ml micro-centrifuge tube. 

5. Centrifuge at 4ºC for 15 min at 13000 rpm. 

6. Discard the supernatant. 

7. Resuspend the pellet in 750 µl of hot (55º C) CTAB buffer (2% (w/v) CTAB, 100 mM Tris- 

HCl [pH 8.0], 20 mM EDTA [pH 8.0], 1.4 M NaCl, 1% (w/v) PVP-40). The pellet is 

easier to resuspend in a smaller volume of CTAB buffer (e.g. 100 µl) then the remaining 

volume of CTAB buffer is added (e.g. 650 µl). 

8. Incubate tubes at 55 ºC for 30 min with intermittent shaking. 

9. Cool the tubes on ice for 30 sec. 

10. Add 750 µl chloroform:octanol (24:1 v/v) and vortex thoroughly. 

11. Centrifuge at 4ºC or at room temperature for 4 min at 13000 rpm. 

12. Carefully remove upper aqueous layer into a clean 1.5 ml micro-centrifuge tube. 

13. Add 1 volume ice-cold isopropanol and vortex thoroughly. 

14. Incubate on ice for 4 min. 

15. Centrifuge at 4ºC or at room temperature for 10 min at 13000 rpm. 

16. Discard supernatant. 


32

17. Wash DNA pellets with 500 µl ice-cold 70% (v/v) ethanol, centrifuge at 4 o C or at room 

temperature for 10 min at 13000 rpm. 

18. Dry DNA pellets in the DNA concentrator or air-dry. 

19. Resuspend in 20 µl sterile distilled water. Incubating the tubes at 55 o C for 10 min can aid 

DNA resuspension. 

20. Store DNA at -20ºC for short-term storage or -80ºC for long-term storage. 


33

Ipomoea (Sweetpotato/Kumara) Post-Entry Quarantine Testing Manual

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?