Molecular Phylogenetics and Evolution 56 (2010) 355–369
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution
journal homepage: www.elsevier.com/locate/ympev
Molecular phylogeny of the subtribe Melinidinae (Poaceae: Panicoideae:
Paniceae) and evolutionary trends in the homogenization of inflorescences
Diego L. Salariato *, Fernando O. Zuloaga, Liliana M. Giussani, Osvaldo Morrone
Instituto de Botánica Darwinion, Labardén 200, Casilla de Correo 22, B1642HYD, San Isidro, Buenos Aires, Argentina
a r t i c l e
i n f o
Article history:
Received 11 November 2009
Revised 27 January 2010
Accepted 2 February 2010
Available online 10 February 2010
Keywords:
Eriochloa
Inflorescences
Molecular phylogeny
Melinidinae
Paniceae
Poaceae
Urochloa
a b s t r a c t
The subtribe Melinidinae (Poaceae: Panicoideae: Paniceae) includes 14 genera that present the PCK photosynthetic subtype in addition to several other unique and also common characters. The purpose of this
research was (1) to test the monophyly of the subtribe Melinidinae, including 331 ndhF sequences of Panicoids and related genera, (2) to analyze the phylogenetic relationships among genera of Melinidinae
using four cpDNA regions, and (3) to study evolutionary trends in the homogenization of inflorescences.
As a result, the monophyly of Melinidinae is supported if Urochloa venosa is excluded from the subtribe.
Alloteropsis semialata subsp. semialata, an unusual PCK species, is here confirmed within the Forest shade
clade. Within Melinidinae, Urochloa and Eriochloa appeared as paraphyletic and polyphyletic genera,
respectively. Finally, the general trend in the evolution of the inflorescences in Melinidinae seems to
be the reduction from non-homogenized to complete homogenized inflorescences.
Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction
Within the Paniceae, subtribe Melinidinae Pilg. includes 14 genera: Chaetium Nees, Eccoptocarpha Launert, Eriochloa Kunth, Leucophrys Rendle, Louisiella C.E. Hubb. & J. Léonard, Megathyrsus
(Pilg.) B.K. Simon & S.W.L. Jacobs, Melinis P. Beauv, Moorochloa Veldkamp, Rupichloa Salariato & Morrone, Scutachne Hitchc. & Chase,
Thuarea Pers., Trichlolaena Schrad., Urochloa P. Beauv. [including
Brachiaria (Trin.) Griseb.], and Yvesia A. Camus (Gutiérrez et al.,
1974, 1976; Ellis, 1977, 1988; Brown, 1977; Hattersley, 1984,
1987; Hattersley and Watson, 1992; Morrone and Zuloaga, 1992,
1993; Zuloaga et al., 2007). Traditionally, C4 grasses were classified,
according to the descarboxylating enzymes used to liberate CO2
from C4 acids, in three major photosynthetic subtypes: NAD-me,
NADP-me, and PCK (Brown, 1977; Ellis, 1977; Hattersley and Watson, 1992). Subtribe Melinidinae was characterized by having a
PCK subtype (Gutiérrez et al., 1974; Prendergast et al., 1987; Hattersley, 1987; Hattersley and Watson, 1992; GPWG, 2001; Zuloaga
et al., 2007). Furthermore, each photosynthetic subtype was associated with a particular leaf anatomy: the PCK subtype was characterized by the presence of a double bundle sheath, around the
vascular bundles, with specialized chloroplasts present in the outer
parenchymatous sheath, and centrifugally located (Ellis, 1977,
1988; Brown, 1977; Hattersley and Watson, 1992; Dengler and
* Corresponding author. Fax: +54 11 4747 4748.
E-mail address: dsalariato@darwin.edu.ar (D.L. Salariato).
1055-7903/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2010.02.009
Nelson, 1999). Nevertheless, this correlation is not unequivocal,
since significant PCK activity has been detected in NADP-me species (Voznesenskaya et al., 2006). Ueno and Sentoku (2006) reported high levels of PCK activity in Alloteropsis semialata (R. Br.)
Hitchc. subsp. semialata, a species with a classical NADP-me anatomical subtype and recently, Christin et al. (2009) demonstrated
that the PCK pathway appears in different NADP-me lineages in
Panicoideae, emphasizing the overlap between the different C4
subtypes.
Urochloa is the largest genus of the Melinidinae, with almost
110 species distributed in tropical and subtropical regions of the
World. The systematic delimitation of Brachiaria and Urochloa
has been controversial; as a result, several species have been transferred from Brachiaria to Urochloa or segregated into other genera
of the Paniceae (Nguyen, 1966; Webster, 1987; Ashalatha and Nair,
1993; Morrone and Zuloaga, 1992, 1993; Veldkamp, 1996; Simon
and Jacobs, 2003; Salariato et al., 2009).
The monophyly of Melinidinae has been recovered in recent
works (Goméz-Martínez and Culham, 2000; Giussani et al., 2001;
Aliscioni et al., 2003; Christin et al., 2007, 2008; Vicentini et al.,
2008); these studies were based in a few taxa, with no more than
seven species belonging to five different genera. Torres González
and Morton (2005) completed the first phylogenetic study of Urochloa, using ribosomal ITS sequences and morphology. These
authors concluded that Urochloa appears as a paraphyletic genus,
including Brachiaria spp. (= Moorochloa), Eriochloa, Melinis, and
Urochloa maxima (= Megathyrsus). Recently, Salariato et al. (2009)
356
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
performed a chloroplast phylogenetic research of the subtribe, discussed the paraphyly of Urochloa, which included species of Eriochloa and Megathyrsus, and segregated two species of Urochloa
into the new genus Rupichloa.
Inflorescences are highly diverse in species and genera of the
Melinidinae, showing different degrees of branching. Reinheimer
et al. (2005, 2009) and Reinheimer and Vegetti (2008) found,
studying the diversity of inflorescences in Melinidinae, three different degrees of homogenization (i.e., degree of similarity among
branches): (1) non-homogenized (Fig. 1A), (2) partially homogenized (Fig. 1B), and (3) fully homogenized (Fig. 1C). In fully homogenized inflorescences, the degree of ramification is the same along
primary branches. On the other hand, partially homogenized inflorescences have primary branches with a different degree of ramification, in relation to their placement in proximal, middle or distal
regions. Two different types of primary branches are observed in
fully homogenized or partially homogenized inflorescences: short
primary branches, or short paracladia, and long primary branches
or long paracladia (Weberling et al., 1997). In non-homogenized
inflorescences the differentiation between long and short paracladia is absent (Cámara Hernández and Rua, 1991; Vegetti and Anton, 2000; Reinheimer and Vegetti, 2008).
The main purpose of this work is to analyze and resolve phylogenetic relationships of taxa within the subtribe Melinidinae,
expanding the sample of species and genera; and analyzing the
evolutive changes in the inflorescence patterns. As a result, this research has three principal goals: (1) to test the monophyly of the
subtribe Melinidinae based on a complete sample of ndhF sequences of the subfamily Panicoideae, (2) to clarify the relationships among genera of Melinidinae using sequences of four
chloroplast regions, and (3) to evaluate the evolutionary trends
of the homogenization process in the inflorescences of Melinidinae.
2. Materials and methods
2.1. Taxon sampling
Sixty-nine species traditionally included in Melinidinae and
with the classical C4 PCK subtype were sampled representing almost all genera of the ingroup: Brachiaria (3), Chaetium (1), Eriochloa (9), Leucoprhys (1), Melinis (2), Megathyrsus (2), Moorochloa
(2), Panicum (1), Rupichloa (2), Scutachne (1), Thuarea (1) Tricholaena
A
B
(1), Urochloa (42), and Yvesia (1) (Table 1); only the monotypic
genus Eccoptocarpha from South-Central Africa, could not be sampled. It should be stressed that a few species of Brachiaria were
considered as Moorochloa (Veldkamp, 2004), whereas three species
of Brachiaria, B. longiflora Clayton, B. pseudodichotoma Bosser, and B.
serrata (Thunb.) Stapf, should be, according to our results, transferred to Urochloa s.l. or accommodated in another genera in
Melinidinae. Since the results are not conclusive, from a taxonomic
point of view, we did not make nomenclatural changes at this
point. The taxa here included were selected to represent the morphological and geographical variation of the subtribe. Additionally,
260 Panicoid species (Paniceae: 199, Andropogoneae: 58, and
Arundinelleae: 3) plus Gynerium sagittatum (Aubl.) P. Beauv. (incertae sedis) and Chasmanthium latifolium (Michx.) H.O. Yates (Centothecoideae) were included as outgroup to test the monophyly of
Melinidinae (all downloaded from GenBank, Supplementary data,
Table S1).
To analyze the phylogenetic relationships within Melinidinae, a
total of 67 PCK species were incorporated as ingroup, with Yvesia
madagascariensis and Urochloa villosa missing from the analyses.
According to previous and current results (Giussani et al., 2001;
Christin et al., 2008; Vicentini et al., 2008), Digitaria ciliaris, (Retz.)
Koeler, Panicum repens L. and Setaria sulcata Raddi were selected as
outgroups. All new sequences were submitted to GenBank (http://
www.ncbi.nlm.nih.gov), voucher information and GenBank accession numbers are provided in Table 1.
2.2. DNA extraction, amplification, sequencing, and alignment
Total DNA was isolated from fresh or silica gel dried leaves
using modified CTAB protocols (Doyle and Doyle, 1987; Murray
and Thompson, 1980; Saghai-Maroof et al., 1984), or from herbarium material using a Dneasy Plant Mini kit (Qiagen, Hilden,
Germany).
Sequences of four chloroplast regions: rpl16, trnL intron, trnL-F
spacer, and ndhF, were used in the analyses. The rpl16 region corresponds to the intron and partial sequences of the gene encoding
ribosomal protein L16 (Kelchner and Clark, 1997; Zhang, 2000;
Cialdella et al., 2007). It was amplified in one fragment using primers F71 of Jordan et al. (1996) and R1661 of Kelchner and Clark
(1997), or partitioned in two fragments using the internal primers
F584 (50 TTCATTGGGTGGGATGGCGGAA30 ) and R584 (50 TTCCGC
C
Fig. 1. Diagrams of inflorescences showing different degree of homogenization. (A) Non-homogenized inflorescence. (B) Partially homogenized inflorescence. (C) Fully
homogenized inflorescence. SP, short paracladia; LP (1°), long paracladia of first order; LP (2°), long paracladia of second order.
Table 1
Sampled taxa with voucher information and GenBank accession numbers.
Taxon
GenBank accession number
rpl16
trnL-F
ndhF
Argentina, Misiones: Zuloaga & Morrone 6753 (SI)
Argentina, Salta: Morrone et al. 4548 (SI)
Uruguay, Colonia: Morrone et al. 5229 (SI)
FJ4865414
EU9200544
EU9200534
AF5099612
AF4991632
GU594532*
AY0296301
AF4991472
AY0296511
Kenya, Kilifi: Faden 71/807 (US)
Madagascar, Toliara: Phillipson & Rabesinaka 3180 (US)
Kenya: CIAT 16952 (SI)
Mexico: Benth. ex Hemsl. Clark s.n. (ISC)
Mexico, Coahuila: Zuloaga 9737 (SI)
Bolivia, Ñuflo de Chavez: Morrone & Belgrano 4987 (SI)
Tanzania, Kilosa: Greenway & Kanuri 15227 (US)
Argentina, Formosa: Zuloaga & Morrone 7251 (SI)
Argentina, Corrientes: Sin colector s.n. (SI)
Puerto Rico, Sierra de Luquillo: Proctor Thomas 43207 (US)
Argentina, Misiones: Zuloaga & Morrone 6838 (SI)
Mexico: Stapper 64 (COAH)
Cuba: Zuloaga 9629 (SI)
Namibia, Keetmanshoop: Crook 1005 (US)
Argentina, Salta: Morrone et al. 3343 (SI)
Uganda, Entebbe: Hitchcock 24067 (US)
Argentina, Misiones: sin colector s.n. (SI)
Argentina, Misiones: Zuloaga & Morrone 6764 (SI)
Argentina, Entre Ríos: Zuloaga & Morrone 7045 (SI)
South Africa: O.H. Volk 510 (US)
Tanzania, Kilimanjaro: Endlich 488 (US)
Cuba: Ekman 996 (MO)
Brazil, Bahía: Zuloaga s.n. (SI)
Brazil, Bahía: Zuloaga & Morrone 6942 (SI)
Republic of Philipines, Luzon: Williams 220 (US)
Pretoria, Traansval: Gogfrey & Meeuse SH-1596 (US)
Paraguay, Presidente Hayes: Zuloaga & Morrone 7318 (SI)
Mexico Oaxaca, Rivera 13535 (MO)
Mexico, Oaxaca: Zuloaga 7413 et al. (SI)
Zimbabwe, Goromonzi: CIAT 16847 (SI)
Ecuador, Napo: Quintana & Laeggard 305 (SI)
Argentina, Corrientes: Zuloaga & Morrone 7119 (SI)
Zimbabwe, Kariba: CIAT 16856 (SI)
Mexico, Michoacán: Morrone & Giussani 3646 (SI)
Mexico, Oaxaca: Zuloaga et al. 7415 (SI)
Zimbabwe: CIAT 26644 (SI)
Paraguay, Amambay: Zuloaga & Morrone 7288 (SI)
Sudan, Ash Shamali: Shantz 921 (US)
Belgian Congo, Katanga: Shantz 586 (US)
Australia, Queensland: Snow & Simon 7332 (MO)
Mexico, Puebla: Zuloaga et al. 7385 (SI)
Moluccan islands, Morotai: Main & Aden 1563 (US)
New Guinea, Western New Guinea: Brass 7810 (US)
Venezuela, Portuguesa: Morrone et al. 4696 (SI)
Kenya, CIAT 16516 (SI)
Ethiopia, CIAT 16212 (SI)
Ghana: CIAT 26886 (SI)
Kenya, Kilifi: CIAT 16546 (SI)
GU594514*
GU594521*
GU594500*
GU594519*
GU594528*
GU594510*
GU594516*
GU594491*
GU594498*
GU594523*
FJ4865554
GU594529*
GU594518*
GU594522*
FJ4865504
GU594511*
FJ4865514
FJ4865594
FJ4865524
FJ4865644
GU594525*
GU594509*
FJ4865604
FJ4865534
GU594517*
FJ4865634
GU594492*
GU594507*
FJ4865444
FJ4865574
FJ4865464
FJ4865564
FJ4865624
GU594497*
FJ4865454
GU594503*
FJ4865494
GU594513*
GU594526*
GU594512*
GU594494*
GU594520*
GU594524*
FJ4865474
FJ4865584
GU594508*
FJ4865614
GU594501*
GU594581*
GU594587*
GU594558*
AF5099622
GU594594*
GU594573*
GU594583*
GU594535*
GU594553*
GU594589*
GU594554*
GU594595*
GU594585*
GU594588*
GU594547*
GU594575*
GU594549*
GU594561*
GU594550*
GU594576*
GU594591*
GU594572*
GU594562*
GU594551*
GU594584*
GU594574*
GU594537*
GU594569*
GU594536*
GU594557*
GU594542*
GU594555*
GU594571*
GU594548*
GU594538*
GU594564*
GU594546*
GU594580*
GU594592*
GU594578*
GU594540*
GU594586*
GU594590*
GU594544*
GU594559*
GU594570*
GU594567*
GU594560*
GU594621*
GU594627*
GU594607*
AY0296261
GU594634*
GU594617*
GU594623*
GU594598*
GU594605*
GU594629*
FJ4865284
GU594635*
GU594625*
GU594628*
AY0296491
GU594618*
FJ4865244
FJ4865324
FJ4865254
FJ4865364
GU594631*
GU594616*
AY0296921
FJ4865264
GU594624*
FJ4865354
GU594599*
GU594614*
FJ4865174
FJ4865304
FJ4865204
FJ4865294
FJ4865344
GU594604*
FJ4865184
GU594610*
FJ4865234
GU594620*
GU594632*
GU594619*
GU594601
GU594626*
GU594630*
FJ4865214
FJ4865314
GU594615*
FJ4865334
GU594608*
357
(continued on next page)
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
Outgroup
Digitaria ciliaris (Retz). Koeler
Setaria sulcata Raddi
Panicum repens L.
Ingroup
Brachiaria longiflora Clayton
Brachiaria pseudodichotoma Bosser
Brachiaria serrata (Thunb.) Stapf
Chaetium bromoides (J. Presl) Benth. ex Hemsl.
Eriochloa acuminata (J. Presl) Kunth
Eriochloa distachya Kunth
Eriochloa meyeriana (Nees) Pilg.
Eriochloa montevidensis Griseb.
Eriochloa nana Arriaga
Eriochloa polystachya Kunth
Eriochloa punctata (L.) Desv. ex Ham.
Eriochloa sericea (Scheele) Munro ex Vasey
Eriochloa setosa (A. Rich.) Hitchc.
Leucophrys mesocoma (Nees)
Megathyrsus maximus (Jacq.) B.K. Simons & S.W.L. Jacobs
Megathyrsus infestus (Peters) B.K. Simons & S.W.L. Jacobs
Melinis minutiflora P. Beauv.
Melinis repens (Willd.) Zizka
Moroochloa eruciformis (Sm.) Veldkamp
Moorochloa malacodes (Mez. & K. Schum.) Veldkamp
Panicum deustum Thunb.
Scutachne dura Hitchc. & Chase
Rupichloa acuminata (Renvoize) Salariato & Morrone
Rupichloa decidua (Morrone & Zuloaga) Salariato & Morrone
Thuarea involuta (G. Forst.) R. Br. ex Sm.
Tricholaena monachne (Trin.) Stapf & C.E. Hubb.
Urochloa adspersa (Trin.) R.D. Webster
Urochloa arizonica (Scribn. & Merr.) Morrone & Zuloaga
Urochloa arrecta (Hack. ex T. Durand & Schinz) Morrone & Zuloaga
Urochloa bovonei (Chiov.) A.M. Torres & C.M. Morton
Urochloa brizantha (Hochst. ex A. Rich.) R.D. Webster
Urochloa decumbens (Stapf) R.D. Webster
Urochloa deflexa (Schumach.) H. Scholz
Urochloa discifera (E. Fourn.) Morrone & Zuloaga
Urochloa distachya (L.) T.Q. Nguyen
Urochloa dura (Stapf.) A.M. Torres & C.M. Morton
Urochloa dyctioneura (Fig. & De Not.) Veldkamp
Urochloa comata (Hochst. ex Rich.) Sosef
Urochloa echinolaenoides Stapf
Urochloa foliosa (R.Br.) R.D. Webster
Urochloa fusca (Sw.) B.F. Hansen & Wunderlin
Urochloa glumaris (Trin.) Veldkamp
Urochloa holosericea (R. Br.) R.D. Webster
Urochloa humidicola (Rendle) Morrone & Zuloaga
Urochloa jubata (Fig. & De Not.) Sosef
Urochloa lachnantha (Hochst.) A.M. Torres & C.M. Morton
Urochloa lata (Schumach.) C.E. Hubb.
Urochloa leersioides (Hochst.) A.M. Torres & C.M. Morton
Voucher information
358
(1) Giussani et al. (2001); (2) Doust and Kellogg (2002); (3) Christin et al. (2008); (4) Salariato et al. (2009). Sequence marked with an asterisk were generated to this study.
ndhF
FJ4865224
GU594602*
GU594597*
FJ4865164
AY0296911
GU594606*
FJ4865384
FJ4865194
FJ4865274
AY0296931
GU594609*
GU594600*
GU594633*
GU594603*
GU594613*
GU594612*
GU594611*
FJ4865374
GU594622*
AM8491323
GU594636*
trnL-F
GU594545*
GU594541*
GU594534*
GU594532*
GU594596*
GU594556*
GU594579*
EU9200564
GU594552*
GU594533*
GU594563*
GU594539*
GU594593*
GU594543*
GU594568*
GU594566*
GU594565*
GU594577*
GU594582*
–
–
rpl16
Argentina, Salta: Cialdella et al. 562 (SI)
Mexico, Michoacán: Morrone & Giussani 3611 (SI)
Venezuela, Miranda: Morrone et al. 4663 (SI)
Argentina, Sgo. Del Estero: Sulekic et al. 3819 (SI)
Argentina, Zuloaga & Morrone 7421 (SI)
Zimbabwe: CIAT 16912
Ecuador, Azuay: Holm-Nielser et al. 4926 (MO)
Mexico, Mexico: Zuloaga et al. 7358 (SI)
Argentina, Jujuy: Morrone et al. 3675 (SI)
Argentina: Sulekic s.n. (SI)
Rwanda, Butare: CIAT 26340 (SI)
Mexico, Michoacán: Morrone & Giussani 3613 (SI)
Tanzania, Dar es Salaam: Wingfield 3145 (US)
Ecuador, Napo: Quintana & Laegaard 363 (SI)
Thailand, Chiang Mai: Laegaard 21775 (SI)
Tobago: CIAT 26894 (SI)
Zimbabwe, Iyanga: CIAT 16962 (SI)
USA, Mississippi: Bryson & Morris 6906 (MO)
Mexico, Michoacán: Leaventworth 481 (MO)
T Renaud 09-2005 (G)
Madagascar, Mahajanga: Bathie 11055
Urochloa lorentziana (Mez) Morrone & Zuloaga
Urochloa meziana (Hitchc.) Morrone & Zuloaga
Urochloa mollis (Sw.) Morrone & Zuloaga
Urochloa mosambicensis (Hack.) Dandy
Urochloa mutica (Forssk.) T.Q. Nguyen
Urochloa nigropedata (Munro ex Ficalho & Hiern) A.M. Torres & C.M. Morton
Urochloa oblita (Swallen) Morrone & Zuloaga
Urochloa panicoides P. Beauv.
Urochloa paucispicata (Morong.) Morrone & Zuloaga
Urochloa plantaginea (Link.) R.D. Webster
Urochloa platynota (K. Schum.) Pilg.
Urochloa platyphylla (Munro ex C. Wright) R.D. Webster
Urochloa rudis Stapf
Urochloa ruziziensis (R. Germ. & Evrard) Crins
Urochloa setigera (Retz.) Stapf
Urochloa subquadripara (Trin.) R.D. Webster
Urochloa subulifolia (Mez) A.M. Torres & C.M. Morton
Urochloa texana (Buckley) R.D. Webster
Urochloa venosa (Swallen) Morrone & Zuloaga
Urochloa villosa (Lam.) T.Q. Nguyen
Yvesia madagascariensis A. Camus
FJ4865484
GU594495*
GU594490*
FJ4865424
GU594530*
GU594499*
FJ4865664
EU9200554
FJ4865544
FJ4865434
GU594502*
GU594493*
GU594527*
GU594496*
GU594506*
GU594505*
GU594504*
FJ4865654
GU594515*
–
–
Voucher information
Taxon
Table 1 (continued)
GenBank accession number
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
CATCCCACCCAATGAA30 ). When amplification failed, primers R270
(Zhang, 2000), and F80 (50 C/TTATTGCTTCGTATTGTCG30 ) were used.
The trnL intron and trnL-F spacer were amplified by PCR in one or
two fragments using primers C, D, E, and F of Taberlet et al. (1991).
For taxa where primer C and/or F failed, primers Cii (50 TAGAC
GCTACGGACTTGATTG30 ) and Fdw (50 CAGTCCTCTGCTCTACCAGC30 )
were used. The ndhF gene was mostly amplified using two pairs
primers 5F/972R and 972F/2110R; through additional set of primers 536R, 536F, 1318R, and 1318F (Olmstead and Sweere, 1994)
were used when the others failed.
Polymerase chain reactions (PCRs) were performed in 25 or
50 ll containing 20–40 ng/ll of DNA template, and a final concentration of 1 PCR Buffer minus Mg, 5 mM MgCl2, 0.025 mM dNTP
each, 0.2 lM each primer, and 1.25–3 U Taq Polymerase, recombinant from Invitrogen life technologies. PCR amplifications were set
at the following conditions for most of the species: (1) rpl16: 1 cycle of 94 °C for 4 min, 34 cycles of 94 °C for 1 min, 55 °C for 1 min,
and 72 °C for 2 min 30 s, and a final extension cycle of 72 °C for
7 min; (2) trnL-F: 1 cycle of 94 °C for 5 min, 34 cycles of 94 °C for
30 s, 48 °C for 1 min, and 72 °C for 1 min 30 s, and a final extension
cycle of 72 °C for 7 min; (3) ndhF: 1 cycle of 96 °C for 4 min, 39 cycles of 94 °C for 1 min 30 s, 55 °C for 1 min, and 72 °C for 1 min
30 s, and a final extension cycle of 73 °C for 7 min. For the species
that failed these protocols, variations in the annealing temperature
(1–8 °C), and number of cycles were followed. In addition, a variety
of PCR additives and enhancing agents (bovine serum albumin, dimethyl sulfoxide, formamide) have been used to increase the yield,
specificity and consistency of PCRs.
Macrogen, Inc. performed cleaning of PCR products using Montage PCR purification kit from Millipore following manufacturer’s
protocol. Sequencing reactions were also performed by Macrogen,
Inc. using a MJ Research PTC-225 Peltier Thermal Cycler and the
ABI PRISM BigDyeTM Terminator Cycle Sequencing Kits with AmpliTaq DNA polymerase (Applied Biosystems), following the protocols supplied by the manufacturer. Sequences were assembled
and edited using the program Chromas Pro v1.41 (Technelysium
Pty, Ltd).
Sequence alignments were generated with Muscle v3.6 (Edgar,
2004) using the default settings. Then alignments were improved
by visual refinement using the program Bioedit v7.0.9.0 (Hall,
1999) and, for the alignment of non-coding chloroplast DNA sequences, we followed recommendations of Kelchner (2000).
All the aligned matrices were submitted to TreeBase (http://
www.treebase.org/treebase); study accession number ‘‘S2633”.
2.3. Monophyly of Melinidinae
The Panicoid ndhF dataset was analyzed using maximum parsimony (MP) and maximum likelihood (ML) approaches. In the analyses, gaps were treated as missing data. For MP analyses, tree
searches were generated with the program TNT v1.1 (Goloboff
et al., 2008) using heuristic searches with 1000 random addition
sequences, tree-bisection-and-reconnection branch swapping
(TBR) and holding 10 trees per replicate; generated trees were then
submitted to a new round of TBR branch swapping to completion.
Support values for nodes were estimated using Jackknife analysis
(Farris et al., 1996) (JK) with 2000 replicates of 10 random addition
sequences, holding 4 trees per replicate and using the default removal probability (0.36). Maximum likelihood analyses were conducted using RAxML v7.0.3 (Stamatakis, 2006). We used the novel
algorithm implemented in RAxML that permit to carry out nonparametric bootstrap analyses (Felsenstein, 1985) (BS) and
searches for the best-scoring ML tree in one single run (Stamatakis
et al., 2008). We executed 1000 rapid bootstrap inferences and
thereafter a thorough ML search under the GTRMIX model with
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
the default number of rate categories and e (25 and 0.1,
respectively).
Additionally, the hypothesis of monophyly of the subtribe
Melinidinae was tested using the SH test (Shimodaira and Hasegawa, 1999) implemented in PAUP v4.0b10 (Swofford, 2003). The
significance of differences between the best ML tree and the best
ML constrained tree was determined using 1000 BS replicates
and the hypothesis was rejected when p < 0.01.
2.4. Relationships within Melinidinae
Datasets from rpl16, trnL intron, trnL-F spacer, and ndhF, representing the subtribe Melinidinae, were analyzed separately or
combined using maximum parsimony and Bayesian inference
(BI). Gaps were coded as presence or absence using ‘‘simple indel
coding” method implemented by Simmons and Ochoterena
(2000) and included in the MP analyses. Only gaps derived from
ambiguous alignment regions of mononucleotide repeat units
(poly-N’s) were discarded following recommendations of Kelchner
(2000). Settings for maximum parsimony searches were similar to
the ones used in previous analyses, and Jackknife support was performed using 10,000 replicates.
Bayesian analyses were conducted using MrBayes v3.1.2 (Huelsenbeck and Ronquist, 2001). Models of nucleotide substitution
were selected by the Akaike Information Criterion (AIC) implemented in Modeltest v3.7 (Posada and Crandall, 1998):
K81uf + I + G (rpl16), HKY + I + G (trnL intron), K81uf + G (trnL-F
spacer), and TVM + I + G (ndhF). Models were set in MrBayes as
nst = 6, rates = invgamma (except for trnL-F spacer which used
rate = gamma) with rate matrix parameters, state frequencies,
gamma shape parameter, and proportion of invariable sites unlinked across partitions. The priors on state frequencies, rates
and shape of the gamma distribution were estimated automatically from the data assuming no prior knowledge about their values (uniform Dirichlet prior). Two simultaneous analyses,
starting from different random trees and with four Markov Monte
Carlo chains were run for 8 million generations and sampled every
1000 generations to ensure independence of the successive samples. The first 2000 trees (25% of total trees) were discarded as
burn-in. The convergence and the effective sample size (ESS) of
each replicate were checked using Tracer v. 1.4 (Rambaut and
Drummond, 2007). The remaining 6001 samples of each run were
combined and a 50% majority rule consensus from 12,002 trees
was calculated. Additionally, the monophyly of Urochloa and Eriochloa was tested under the SH test using a thorough ML search of
the constrained topologies in RAxML with 1000 replicates and
the GTRMIX model.
2.5. Trends in the homogenization of the inflorescences in Melinidinae
The degree of homogenization was coded as a three state discrete character [non-homogenized inflorescence (0), a partially
homogenized inflorescence (1), and a fully homogenized inflorescence (2)] following the criteria cited by Cámara Hernández and
Rua (1991), Reinheimer and Vegetti (2008) and Perreta et al.
(2009). In non-homogenized inflorescences, branches present different degree of ramification along the inflorescence and do not
show specialization (Fig. 1A). In contrast, in partially homogenized
inflorescences, the basal branches are more extensively branched
with respect to the distal and median branches, but is possible to
recognized two types of branches: long branches (or long paraclades, ‘‘LP” Fig. 1B) and short branches (or short paraclades, ‘‘SP”
Fig. 1B). In the fully homogenized inflorescence is also possible to
recognize long and short paraclades, but the degree of ramification
is the same for all branches. The character state assignation was
done examining one to ten specimens per taxon (depending of
359
the availability of material, see Supplementary material Appendix
S1 and S2) and checked with the observations reported by Reinheimer and Vegetti (2008). Although the number of branches per
inflorescence resulted highly variable within species, the degree
of homogenization was constant, and only Chaetium bromoides,
that presented both partially and fully homogenized inflorescences, was codified as polymorphic (1,2). Other characters related
with the inflorescence as truncation of the terminal spikelet, symmetry of the inflorescence or stages in the differentiation were not
included here, because they involve developmental studies that exceed the scope of this paper. Ancestral states of the degree of
homogenization and the instantaneous transition rate were reconstructed employing a continuous-time Markov model of trait evolution (Pagel, 1994, 1997) implemented in Bayestraits v1.0 (Pagel
and Meade, 2007) with six instantaneous rates representing all
possible state changes. Two models of character evolution were assayed: the first model assumes all character state transitions unordered (i.e., direct transitions are possible among all character
states) whereas the second model assumes character state transitions ordered (i.e., transitions between non-homogenized and fully
homogenized states are constrained to pass through a partially
homogenized state) (Bradley et al., 2008). The models were compared using approximate Bayes Factor (BF). The BF approach was
based on smoothed estimates of marginal likelihood analyzed with
Tracer v1.4, which applies the method used by Newton and Raftery
(1994) with modifications by Suchard et al. (2001).
Ancestral states were reconstructed by maximum likelihood
(Pagel, 1997, 1999) using the ML tree (topology as well as branch
lengths). For this purpose, the combined dataset (rpl16/trnL/trnLF/ndhF) was subjected to a ML search using RAxML under four partitions, 1000 replicates and the GTRMIX model.
When reconstructing the instantaneous transition rates of different states, we used the MCMC method implemented in Bayestraits. In contrast to the optimality criterion (parsimony or
likelihood), the Bayesian MCMC method has the advantage to integrate the uncertainty of the phylogeny and the parameters of the
model for trait evolution (Pagel et al., 2004). The analyses were
executed using the 12,002 trees obtained in the bayesian analyses,
and an exponential prior for rates coefficients were used. Because
there is little information about the mean of exponential prior, this
parameter was seeded from a uniform hyperprior, which allows
values of the prior to be estimated from the data (Pagel and Meade,
2006). The ranges for the uniform hyperprior were obtained using
an empirical approach: the package BayesMultistate (included in
Bayestraits) was used to estimate the rate coefficient on each of
the bayesian trees under maximum likelihood and then these values were used to set the range of the hyperprior. Two independent
analyses were run for 10 million generation and sampled every
1000 generations to ensure independence. The first 1 million generations were discarded as burn-in (convergence and ESS were
checked with Tracer) and the rest of the samples from the two replicates were combined (18,002 samples). Finally, we calculated the
global rate of the homogenization process as qhomogenization =
q01 + q12 + q02 and qde-homogenization = q10 + q21 + q20 for the inverse
process. The statistical differences among pairs of rates were
studied using the non-parametric Mann–Whitney U-test in the
program Statistica v7.0 (StatSoft, Inc., 2004).
3. Results
3.1. Monophyly of Melinidinae (ndhF phylogeny)
Maximum likelihood and maximum parsimony topologies resulted highly congruent when analyzing 331 ndhF sequences of
the subfamily Panicoideae and its closest relatives: a total of 67%
360
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
Fig. 2. Maximum likelihood tree of the subfamily Panicoideae (ndhF sequences). The squares indicate important groups within Panicoideae. The Melinidinae clade is
indicated with a white square. The black row shows the node of the Melinidinae – Panicum clade, the white circle shows the position of Alloteropsis semialata ssp. semialata,
the black square shows the position of Urochloa venosa within the Panicum clade. ML values of maximum likelihood bootstrap support; MP, values of maximum parsimony
jackknife support.
361
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
and 57% of the nodes were recovered with P50% ML bootstrap and
MP jackknife support, respectively. Three major clades, correlated
with the basic chromosome number, were found in agreement
with previous reports (Giussani et al., 2001; Christin et al., 2008;
Vicentini et al., 2008). All C4-PCK taxa, classified under the subtribe
Melinidinae, except for Urochloa venosa, were recovered in a monophyletic group with moderate support (83% BS, 68% JK), and included in the x = 9 Paniceae clade (BS 99%, JK 78%). Alloteropsis
semialata subsp. semialata, a species reported as having high PCK
activity, was excluded of the Melinidinae clade (Fig. 2). When U.
venosa and A. semialata subsp. semialata were included, the
hypothesis of monophyly of the Melinidinae was strongly rejected
under the SH test ( Dln L = 65.48 and 172.41, p < 0.01, respectively). Urochloa venosa appeared in a highly supported clade
(99% BS, 99% JK) with species of Panicum s.s. (Aliscioni et al.,
2003); this clade is sister to the subtribe Melinidinae (66% BS,
55% JK). On the other hand, Alloteropsis semialata subsp. semialata
was placed, together with the remaining species of Alloteropsis, in
the Forest Shade clade, which comprises species of Acroceras, Cyrtococcum, Echinochloa, Lasiacis, Oplismenus, Ottochloa, Panicum incerta sedis species, and Poecilostachys (95% BS, 89% JK; Giussani
et al., 2001; Christin et al., 2008; Ibrahim et al., 2009).
Within clade II, Urochloa, excluding U. venosa, is paraphyletic,
including several other taxa, such as Chaetium, Eriochloa ssp. (except E. distachya), Megathyrsus, Scutachne, and two species still
remaining in Brachiaria, B. serrata and B. pseudodichotoma. The
monophyly of Urochloa was rejected under the SH test
( Dln L = 283.85, p < 0.01).
Several subclades were obtained in clade II (subclades c–p,
Fig. 3). The American species Urochloa lorentziana, U. oblita,
U. paucispicata, and U. texana are included in a strongly supported
group (subclade c, PP 1.0 JK 99%) sister to the rest of species (d,
PP 1.0, JK 99%). In clade II, Eriochloa was divided in three different
groups: E. meyeriana as sister to Urochloa mutica (subclade k,
PP 1.0, JK 100%), while the rest of Eriochloa is monophyletic
(subclade p, PP 1.0, JK 100%) and nested within subclade o with
several Urochloa species, and Chaetium bromoides (PP 1.0, JK
91%); finally, the position of E. sericea is not well-resolved within
this clade. The genus Megathyrsus is monophyletic (subclade j,
PP 1.0, JK 100%) and related to Urochloa mutica, U. deflexa, and
E. meyeriana (subclade i, PP 1.0 JK 72%).
3.2. Phylogenetic analyses of Melinidinae
The unordered model resulted slightly favored over the ordered
model (lnBF = 2.44). In the analyses using the unordered model
only 40% of the nodes resulted strongly unambiguous for the
assignment of some state (p P 0.95) and the partial homogenization of the inflorescences resulted the most frequent assigned state,
with p (assignation probability) P0.5 and P0.95 in 48% and 20% of
the nodes, respectively (Fig. 4A and B). This state was assigned
mainly to shallow and deep nodes within the clade II, i.e., nodes
including low and high number of taxa, respectively (Fig. 4C). The
probability of partially homogenized inflorescences in ancestral
node of clade II was p = 0.82 and within it several subclades showed
p > 0.95 for this state (e.g., clade d and subclade p, ‘‘Eriochloa p.p”).
The non-homogenized state was represented with a low probability
in most ancestral nodes, except in the clade I; only 14% of the nodes
showed p P 0.5 and 3%, p P 0.95. Within clade II, this state was
only present with a high probability in Megathyrsus, subclade j, with
p = 0.99. The fully homogenized state was assigned with high probability mainly to shallow nodes included in the clade II (Fig. 4C).
When the ordered model was applied, the state assignations
were similar to those obtained with the free model (Supplementary data, Fig. S1). Only four nodes showed a strong change in
the assigned state, one from fully to partially homogenized and
three with the inverse change (Fig. S1, A). Furthermore, the ancestral nodes within clade o, excluding Eriochloa, presented an increase of the fully homogenized probability. The fully
homogenization was recovered as the most frequent state assigned
(Fig. S1, B), both in shallow and moderate-deep nodes (up to 31
taxa) (Fig. S1, C) while the partially state continued to be assigned
to deep and shallow nodes.
Characteristics of rpl16, trnL intron, trnL-F spacer, and ndhF sequences are summarized in Table 2. Topologies obtained in all individual analyses were congruent and recovered all PCK genera
previously classified in Melinidinae in a monophyletic clade
(rpl16: PP 1.0, JK 82%; trnL intron/spacer: PP <0.5, JK 65%; ndhF:
PP 1.0, JK 89%). Independent analyses of the markers offered no
contradictory information, so we assumed partitions to be congruent and hence combined all datasets. Results from Bayesian and
parsimony analyses, using the combined dataset (4.8 kb), yielded
highly congruent topologies with all genera included in Melinidinae in a highly supported monophyletic group (PP 1.0, JK 99%)
(Fig. 3).
Two major clades were recovered among species of the Melinidinae clade: clade I (PP 0.58, JK <50%) with Leucophrys, Melinis,
Moorochloa, Rupichloa, Tricholaena, Panicum deustum, and Eriochloa
dystachya; and clade II (PP 1.0, JK 92%), containing all species of
Urochloa, the remaining species of Eriochloa, plus Chaetium, Megathyrsus, and Scutachne. Eriochloa is clearly recovered as a polyphyletic genus; its monophyly is rejected under the SH test
( Dln L = 244.03 p < 0.01). Brachiaria longiflora and Thuarea involuta were recovered, in the Bayesian analysis, as the most basal taxa
of clade II (PP 0.56 and 0.51, respectively). However, B. longiflora
was included in clade I by maximum parsimony analysis.
Within clade I, two major groups of species are supported:
subclade a (PP 1.0, JK 99%), which includes Leucophrys, Melinis,
Moorochloa, and Tricholaena, and subclade b with species of the
Brazilian genus Rupichloa (PP 1.0, JK 99%).
3.3. Evolutionary trends in the homogenization of the inflorescence in
Melinidinae
Table 2
Features of the DNA regions included in this study.
Length of the alignment
Length of sequences (ingroup)
No. of parsimony informative
characters
No. of gaps in the alignment
No. of informative gaps in the
alignment
Model selected by AIC
rpl16
trnL intron
trnL-F spacer
ndhF
1412
1058 (M. repens)–1165 (U.
oblita)
87
612
549 (B. longiflora)–584 (C.
bromoides)
51
652
401 (E. meyeriana)–336 (E.
distachya)
35
2142
2121 (U. deflexa)–2142
(several)
207
55
20
29
7
42
17
4
0
K81uf + I + G
HKY + I + G
K81uf + G
TVM + I + G
362
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
Fig. 3. Majority-rule consensus tree from 12,002 trees obtained in the Bayesian analysis (rpl16/trnL intron/trnL-F spacer/ndhF sequences). The values above and below
branches correspond to the Bayesian posterior probability and parsimony jackknife support, respectively. The letters indicate the clades referred in the text.
The reconstruction of the transition rates based on the bayesian
MCMC method showed that the highest change rate was recovered
from partially homogenized to fully homogenized inflorescences
(q12 = 5.37 ± 1.89) (Fig. 5B); while the lowest change rate corresponds to non-homogenized to fully homogenized inflorescences
(q02 = 0.24 ± 0.29) (Fig. 5C).
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
363
A
B
C
Fig. 4. Reconstruction of the ancestral states for the inflorescence homogenization degree using an unordered model of character evoluion. (A) Maximum likelihood tree of
the Melinidinae clade; ancestral state assignation for non-homogenized (black), partially homogenized (gray), and fully homogenized (white) states are shown in the pie
diagrams; ML bootstrap values are given below branches. (B) Percentage of total nodes with probability values >0.5 (gray) and >0.95 (white) for the non-homogenized,
partially homogenized, and fully homogenized states. (C) Frequency of nodes with ancestral state assignation (p > 0.5) vs. size of the node (as number of taxa that include
these nodes), the number of taxa included in a node is taken as a measure of its depth (see text).
364
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
Fig. 5. Rates of change between the different states of homogenization obtained using an unordered model of character evoluion. (A) q01: rate of change from nonhomogenized to partially homogenized state, q10: the inverse change. (B) q12: rate of change from partially to fully homogenized state, q21: the inverse change. (C) q02: rate of
change from non-homogenized to fully homogenized state, q20: the inverse change. (D) qhomogenization general rate of the homogenization process (q01 + q12 + q02) and
qde-homogenization the inverse process (q10 + q21 + q02). Boxes above the figures show the mean and the standard error for the 18,002 values of each instantaneous transition rate.
The asterisks indicate significant differences under the non-parametric Mann–Whitney U-test.
The statistical differences among pairs of rates, associated to
both evolutionary processes of homogenization vs. de-homogenization, showed that the first process was favored over the latter
one (qhomogenization = 7.61 ± 2.34 vs. qde-homogenization = 4.04 ± 1.64)
(Fig. 5D). The results from the ordered model recovered the same
tendency (Fig. S2).
4. Discussion
4.1. Origin and diversification of Melinidinae
The subtribe Melinidinae, represented in this work by the PCK
genera Brachiaria, Chaetium, Eriochloa, Leucophrys, Megathyrsus,
Melinis, Moorochloa, Rupichloa, Scutachne, Tricholaena, Thuarea, Urochloa, and Yvesia, together with Panicum deustum, resulted unambiguously monophyletic and related to Panicum s.s. Only Urochloa
venosa, initially described as a Panicum species (Swallen, 1950),
was excluded from this clade, a fact that confirm its previous original classification. The segregation of U. venosa from Melinidinae
is also supported by several morphological and anatomical data:
the ornamentation pattern of the upper anthecium in U. venosa is
similar to the pattern found in species of Panicum sect. Panicum
(Zuloaga and Morrone, 1996; Salariato et al., 2008). Also, this species is anatomically identical to species of sect. Panicum which
have been reported with PEP-ck foliar anatomy and NAD-me photosynthetic pathway (e.g., Panicum elephantipes, P. repens, P. virgatum) (Gutiérrez et al., 1974; Brown, 1977; Hattersley and Watson,
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
1992; Prendergast et al., 1987). Therefore, Urochloa venosa should
be treated once again as P. venosum. Panicum deustum, which also
has the classical PCK anatomical type (Ellis, 1988), should be considered in the subtribe Melinidinae, although there are not clear
morphological affinities with genera of the subtribe.
The position of Alloteropsis semialata subsp. semialata, a subspecies with high C4-PCK activity (Ueno and Sentoku, 2006), segregated from the Melinidinae clade and nested within the Forest
shade clade (Giussani et al., 2001) together with other C3 and C4
taxa of Alloteropsis agrees with results of Ibrahim et al. (2009)
and reinforces the existence of multiple PCK lineages, at least six
in subfamily Panicoideae as reported by Christin et al. (2009).
The Melinidinae clade was divided in two major clades, clade I
and II, with Brachiaria longiflora and Thuarea involuta as the most
basal taxa. Brachiaria longiflora is distinguished from species of
Urochloa and Brachiaria (incerta sedis) by its long spikelets with a
prominent callus at the base and the smooth upper anthecium
(Clayton, 1980; Salariato et al., 2008). The genus Thuarea, with only
two species, is clearly distinctive, within Melinidinae, by having a
deciduous foliaceous rachis with spikelets differentiated along
the rachis: the upper portion exclusively with male spikelets and
the lower portion with bisexual spikelets. After the anthesis, the
upper portion of the rachis is folded onto the fertile spikelets forming a woody capsule that is dispersed by water (Clayton and Renvoize, 1986).
4.1.1. Clade I
Clade I included Old World taxa (Leucophrys, Melinis, Panicum
deustum, Moorochloa, and Tricholaena) with the exception of Rupichloa and Eriochloa distachya. Within this clade, subclade a, with
Leucophrys, Melinis, Moorochloa, and Tricholaena, is characterized
by share its taxa a deciduous, chartaceous and smooth upper
anthecium (Clayton and Renvoize, 1986). Moorochloa is distinguished from Urochloa by the presence of unilateral inflorescences,
disarticulation at the base of the upper floret, the callus inconspicuous, and the upper lemma chartaceous with a muticous apex
(Webster, 1987; Morrone and Zuloaga, 1992; Veldkamp, 2004).
Therefore, our results do not agree with the inclusion of the genus
in Urochloa (Torres González and Morton, 2005). The relationship
between Melinis and Tricholaena has been reported by Clayton
and Renvoize (1986), and Zizka (1988), based on a similar paniculate inflorescence with laterally compressed spikelets in both genera. Leucophrys, a monotypic African genus, has been previously
treated under Brachiaria by Camus (1930) and Clayton and Renvoize (1986), and has been morphologically related with Urochloa
lachnantha, U. nigropedata, and Brachiaria serrata (Renvoize et al.,
1996). However, Leucophrys appeared in this analysis clearly segregated from Urochloa, and Brachiaria in its traditional concept, and
related to Melinis and Tricholaena. It differs from the latter genera
by having awnless glumes, the lower glume longer, and upper
anthecium persistent on the spikelet. Rupichloa is a small genus restricted to the pre-Cambrian shield of Central Brazil, distinguished
by being the surface of the upper anthecium longitudinally striate,
with verrucose papillae associated with the transverse anticlinal
cell walls, and with flat macrohairs towards its apex; also, the spikelets are stipitate and arranged in lax and pyramidal inflorescences
(Salariato et al., 2009). The systematic position of Eriochloa distachya is discussed below.
4.1.2. Clade II
In all analyses, Urochloa, once U. venosa is excluded from the
genus, was recovered as a paraphyletic genus, and integrated in a
highly supported clade II with Brachiaria pseudodichotoma and B.
serrata, Chaetium, Eriochloa, Megathyrsus, and Scutachne. Although
the paraphyly of Urochloa is in concordance with the results pub-
365
lished by Torres González and Morton (2005), Melinis and Moorochloa, as previously discussed, are not related with Urochloa.
Several morphological characters had been used to define Urochloa at the generic level, however that characters are not useful
to delimit the genus within Melinidinae. Among these characters
the most important ones were the ornamentation of the upper
anthecium, defined as being transversally rugose (Webster, 1987;
Morrone and Zuloaga, 1992; Ashalatha and Nair, 1993; Veldkamp,
1996). However, the ornamentation of the upper anthecium is
highly variable in Urochloa and presents independent origins in
Melinidinae (Salariato et al., 2008). The abaxial orientation of the
spikelets has also been used to recognize Urochloa (Stapf, 1934;
Clayton and Renvoize, 1982, 1986); nevertheless, this orientation
derives from a reduction process of one of the two spikelets of
the pair, and Urochloa includes species with paired spikelets and
with solitary spikelets, both abaxial or adaxial (Morrone and Zuloaga, 1992). Hence, the spikelet orientation is also not significant for
the recognition of Urochloa.
Several highly supported subclades, comprising species of Urochloa, emerged within clade II. The informal Fasciculata group of
Panicum included several American species latter transferred to
Urochloa (Hitchcock and Chase, 1910; Swallen, 1966; Parodi,
1969; Morrone and Zuloaga, 1992, 1993). Renvoize (1998) suggested that these American species could form a natural group recognizable by the annual habit, the triquetrous rachis and the
paniculate aspect of the inflorescence. However, our results
showed that this group is clearly polyphyletic with three different
positions within clade II: subclade c, h and Urochloa adspersa as an
isolated species; this suggests an independent origin for the characters which defined the group or a reticulation process (i.e.,
hybridization) with other members of Melinidinae.
Subclade e includes two African species, Urochloa comata and
Brachiaria serrata, and one native species from Australia, U. holosericea. These species are morphologically related by its long acuminate spikelets, with distinctive silvery or purplish-silky fringe
of hairs toward the apex (Renvoize et al., 1996; Webster, 1987;
Clayton and Renvoize, 1982), and a similar ornamentation pattern
of the upper lemma: the Brachylopha type (Salariato et al., 2008).
Subclade f, with three Old World species: Urochloa distachya, U.
plantaginea, and U. subquadripara, is characterized by having spikelets with the lower glume clasping the upper glume, a short internode between the lower and upper glumes, and the upper
anthecium flat and dorsally compressed (Hitchcock, 1951; Clayton
and Renvoize, 1982; Morrone and Zuloaga, 1992).
Subclades g and l include species distributed in Africa, all with
solitary spikelets with the upper glume and lower lemma crossveined (Stapf, 1934; Clayton, 1972; Clayton and Renvoize, 1982);
all these species, with the exception of U. dura, were classified by
Stapf (1934) in Brachiaria section Reticulatae.
Members of subclade m: Urochloa arrecta, U. disciphera, and U.
platyphylla, are supported by molecular and morphological synapomorphies: spikelets with lower glume not clasping the upper
glume, and the internode between the lower and the upper glume
absent (Clayton and Renvoize, 1982; Morrone and Zuloaga, 1992).
Urochloa brizantha, U. decumbens, and U. ruziziensis are included
in a highly supported subclade n, characterized by unequivocal
characters of the spikelets such us the ovoid shape, the elongate
internode between glumes and the lower glume embracing the
upper glume (Clayton and Renvoize, 1982; Morrone and Zuloaga,
1992; Renvoize et al., 1996). All three species are native from Africa
and introduced as important worldwide pastures. Furthermore,
interspecific hybrids, with a high degree of chromosome associations, have been reported for U. brizantha, U. decumbens, and U.
ruziziensis (Risso-Pascotto et al., 2005; Mendes et al., 2006; Adamowski et al., 2008), a fact that also supports a close relationship
between these species.
366
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
Finally, the type species of Urochloa, U. panicoides, together with
the remaining species of Urochloa, are recovered in a highly supported and heterogeneous subclade o, which also includes species
of Eriochloa and Chaetium, reinforcing the paraphyletic condition of
Urochloa. Although the most frequent basic chromosome number
in Urochloa is x = 9, other basic numbers, such as 6, 7, 8, and 10, have
been reported for the genus (Basappa et al., 1987; Basavaiah, 1990;
Morrone et al., 1995; Valle and Savidan, 1996; Risso-Pascotto et al.,
2006). Polyploidy is also widespread in Urochloa and tetraploids
are predominant, but other ploidy levels, such as 3, 5, 6, 8, 9, 10x,
were also reported (Spies and Du Plessis, 1986; Basappa et al.,
1987; Basavaiah, 1990; Nadeem Ahsan et al., 1994; Penteado et al.,
2000; Boldrini et al., 2009). Variation in ploidy levels, together with
reports of hybrids found in species of Urochloa (Risso-Pascotto et al.,
2005; Mendes et al., 2006; Adamowski et al., 2008), suggest that
events of reticulate evolution, as hybridization and/or allopolyploidization, could be common processes in the genus, generating potential incongruence between nuclear and plastid data (Linder and
Rieseberg, 2004; McBreen and Lockhart, 2006). Therefore, in order
to elucidate a robust phylogeny of Urochloa, it would be necessary
to complete a nuclear phylogenetic study, analyzing, for example,
single copy genes such as GBSSI, waxi or knotted1 (Doust et al., 2007).
Scutachne is a Caribbean genus with only two species; it is characterized by its stipitate spikelets with the apex acuminate. The
phylogenetic position of S. dura revealed a close relationship with
Urochloa and other species of clade II. A similar result was obtained
with Megathyrsus in agreement with previous phylogenetic studies
(Giussani et al., 2001; Torres González and Morton, 2005).
The phylogenetic position of Chaetium was not resolved by our
analyses, since only C. bromoides, out of the three American species,
was here sampled. Nevertheless, C. bromoides showed a close relationship to species of subclade o (Urochloa spp., and Eriochloa
spp.); morphologically this species shares, with members of clade
o, an aristate apex of the upper lemma and a similar ornamentation
type of the upper anthecium (Salariato et al., 2008). On the other
hand, C. bromoides differs, from taxa of subclade o, by having glumes
and lower lemma bearing awns and spikelets with a sharp and pilose
callus with a disarticulating oblique base (Morrone et al., 1998).
Chaetium bromoides is a species with the PCK anatomical subtype,
while the other two species, C. festucoides and C. cubanum, are distinguished by having a C4 NADP-me anatomical subtype. If Chaetium is
indeed a monophyletic entity, this hypothesis could suggest a reversion from the PCK to the NADP-me pathway, supporting the existence of recurrent switches between these two photosynthetic
subtypes in the Panicoideae (Christin et al., 2009).
Eriochloa resulted polyphyletic with at least four different placements in the Melinidinae clade. These results suggest that the diagnostic character traditionally used to identify this genus, a distinct
enlarged cup-like structure at the base of the spikelet, are not homologue among Eriochloa species. Shaw and Smeins (1979) recognized
three different morphological types of calluses in Eriochloa: type 1,
with a smooth epidermis and pitted with bi-tetralobed silica bodies,
presents in the core Eriochloa species (clade p, excepting E. polystachya); type 2, with a smooth basal portion and without silica bodies in
its surface, presents in E. distachya; and type 3, characterized by a
rough mosaic of tissue in the basal portion, and by encircling part
of the second glume and lower lemma, only presents in E. meyeriana
and E. polystachya. Eriochloa meyeriana, an African species, was included in a highly supported subclade with Urochloa mutica (subclade k); Clayton and Renvoize (1982) also stressed a close
morphological relationship between these two species.
4.2. Taxonomic implications
Although our results are still preliminary, some conclusions can
be suggested, such as: Thuarea, Rupichloa, Moorochloa, Tricholaena,
Leucophrys, and Melinis are distinctive genera within the Melinidinae, and Urochloa venosa has to be treated once again as a species
of Panicum. The taxonomic position of Brachiaria longiflora, Panicum deustum, and Eriochloa distachya is still not clear; these taxa
could represent independent genera within Melinidinae. Two different paths are possible for classification purposes in Urochloa:
the first one would render Urochloa paraphyletic, including species
of Brachiaria, Chaetium, Eriochloa, Megathyrsus, and Scutachne;
while the second one would segregate Urochloa in several small
monophyletic genera. We consider that additional evidence is
needed before taking any taxonomic decision; increasing the number of species sampled, and including a robust nuclear phylogeny.
Finally, more species of Eriochloa should also be analyzed in order
to clarify the segregation of this polyphyletic genus.
4.3. Homogenization of the inflorescence in Melinidinae
According to the ancestral state reconstruction and the transition rates, the process of homogenization appears favored over
the process of de-homogenization. These results are in agreement
with the hypothesis of inflorescence homogenization as a common
evolutionary trend within angiosperms (Troll, 1964, 1969; Weberling, 1992; Vegetti and Anton, 2000). In particular, a similar process of homogenization has been reported in different groups of
subfamily Panicoideae (Rua, 1993, 1996; Pensiero and Vegetti,
2001) and Poaceae (Vegetti, 2000; Liu et al., 2005). Morphological
and molecular studies in Setaria and related genera (Doust and Kellogg, 2002; Doust et al., 2007) showed that inflorescence morphology is highly variable, and is only partially correlated with plastid
or nuclear phylogenies of the group. On the contrary, Liu et al.
(2007) reported, for subfamily Chloridoideae, that inflorescence
morphology is highly congruent with phylogenetic history. In our
analysis, non-homogenized inflorescences were predominant in
ancestral nodes of clade I, with posterior homogenizations attained
in Leucophrys, Moorochloa, Rupichloa, and Eriochloa distachya.
Ancestral nodes of clade II presented partially homogenized inflorescences, switching to a complete homogenization in several
groups. Only reversions to the non-homogenized state were gained
in Megathyrsus and Urochloa comata. In agreement with Reinheimer and Vegetti (2008), the inflorescence morphology tends to become simpler during the evolution of subtribe Melinidinae and
seems to be partially correlated with plastid phylogenies. Nevertheless, since many nodes presented an ambiguous state assignation, the inference about the evolution of this character must be
taken with some caution.
The homogenization of the inflorescences is a process related to
the meristem determinacy (Perreta et al., 2009); meristems can be
indeterminate yielding an indefinite number of organs, or determinate, which are consumed after producing a specific number of organs (Vollbrecht et al., 2005; Bortiri and Hake, 2007). In fully
homogenized inflorescences, the axillary meristems are determinate and generate branches reduced to one spikelet (Perreta
et al., 2009). In this sense, the meristem determinacy would guide
the degree of homogenization. Several genes that control the
development and morphology of the grass inflorescence have been
identified in the last decade (e.g., barren stalk1 (ba1) fascinated ear2
(fea2) thick tassel dwarf1 (td1) knotted1 (kn1), ramosa1 (ra1); (Vollbrecht et al., 2000, 2005; Taguchi-Shiobara et al., 2001; Gallavotti
et al., 2004; Bommert et al., 2005a). Barren inflorescence (bif2) and
barren stalk (ba1) in maize, and lax panicle (lax) in rice, encode basic
helix-loop-helix transcription factors and control early development switches involved in the initiation of axillary meristems
(Bommert et al., 2005b). McSteen (2006) asserts that the evolution
of the ramosa pathway has been involved in the evolution of the
grass inflorescence; the ramosa mutants (ra1, ra2, ra3) present axillary meristems with increased indeterminacy and degree of
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
branching (Bortiri and Hake, 2007). Alternatively, Ikeda-Kawakatsu
et al. (2009) report in rice that the activity of the apo1 regulates the
inflorescence form suppressing the conversion of branch meristems to spikelets through control of cell proliferation in the meristem. Powerful mechanisms of change in the evolution of the grass
inflorescence would involve changes in the pathway of different
transcription factors because they control many developmental
processes (McSteen, 2006). Additionally, genetic networks that affect the different types of inflorescence branch meristems are not
the same, and the fate of the primary branches is independent from
that of higher order branches (Kellogg, 2007).
Homogenization and truncation (loss of the terminal spikelet)
are a reductive process pointed out as the most important evolutionary processes of the inflorescences of Poaceae (Cámara Hernández and Rua, 1991). The homogenization process is usually
associated with the truncation process; however Reinheimer and
Vegetti (2008) have found species of Urochloa that present homogenization without truncation; this usually occurs with partially
homogenized inflorescences.
In this study the homogenization process turned out to be the
general evolutionary trend in the inflorescences of subtribe Melinidinae. However, additional molecular evidences on nuclear phylogenetics and gene expression, combined with ancestral state
reconstructions of additional morphological and ontogenetic inflorescence characters (e.g., truncation of the terminal spikelet, symmetry of the inflorescence, pattern of differentiation) will help to
elucidate the intricate pattern of inflorescence development that
play a fundamental role within the evolution of this group.
Acknowledgments
We are particularly grateful to two anonymous reviewers
which greatly improved the manuscript. We thank Renata Reinheimer for her helpful comments on the manuscript. Bayesian analyses were performed on the CBSU BioHPC cluster at Cornell
University. The free edition of TNT v1.1 is available through the
sponsorship of the Willi Hennig Society. This research was supported by Funding of this research provided by ANPCyT (Agencia
Nacional de Promoción Científica y Técnica, Argentina), Grants
32640 and 01286 and CONICET, Grant 5453. Field collections were
carried out by funds awarded by the National Geographic Society
(Grants #7792-05 and #8365-07) and by Myndel Botanical
Foundation.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.ympev.2010.02.009.
References
Adamowski, E.V., Pagliarini, M.S., Valle, C.B., 2008. Meiotic behaviour in three
interspecific three-way hybrids between Brachiaria ruziziensis and B. brizantha
(Poaceae: Paniceae). J. Genet. 87, 33–38.
Aliscioni, S.S., Giussani, L.M., Zuloaga, F.O., Kellogg, E.A., 2003. A molecular
phylogeny of Panicum (Poaceae: Paniceae). Test of monophyly and
phylogenetic placement within the Panicoideae. Am. J. Bot. 90, 796–821.
Ashalatha, V.N., Nair, V.J., 1993. Brachiaria Griseb. and Urochloa P. Beauv. (Poaceae)
in India – a conspectus. Bull. Bot. Surv. India 35, 27–31.
Basappa, G.P., Muniyamma, M., Chinnappa, C.C., 1987. An investigation of
chromosome numbers in the genus Brachiaria in relation with morphology
and taxonomy. Can. J. Bot. 65, 2297–2309.
Basavaiah, M.T.C., 1990. Karyological studies on five species of Urochloa P. Beauv.
(Poaceae). Cytologia 55, 431–435.
Boldrini, K.R., Pagliarini, M.S., Valle, C.B., 2009. Meiotic behavior of a nonaploid
accession endorses x = 6 for Brachiaria humidicola (Poaceae). Genet. Mol. Res. 8,
1444–1450.
Bortiri, E.C., Hake, S., 2007. Flowering and determinacy in maize. J. Exp. Bot. 58,
909–916.
367
Bommert, P., Lunde, C., Nardmann, J., Vollbrecht, E., Running, M., Jackson, D., Hake,
S., Werr, W., 2005a. Thick tassel dwarf1 encodes a putative maize ortholog of the
Arabidopsis CLAVATA1 leucine-rich repeat receptor-like kinase. Development
132, 1235–1245.
Bommert, P., Satoh-Nagasawa, N., Jackson, D., Hirano, H., 2005b. Genetics and
evolution of inflorescence and flower development in grasses. Plant Cell Physiol.
46, 69–78.
Bradley, M.C., Huelsenbeck, J.P., Wiens, J.J., 2008. Rates and patterns in the evolution
of snake-like body form in squamate reptiles: evidence for repeated reevolution of lost digits and long-term persistence of intermediate body forms.
Evolution 62, 2042–2064.
Brown, W.V., 1977. The Kranz syndrome and its subtypes in grass systematics.
Mem. Torrey Bot. Club 23, 1–97.
Cámara Hernández, J., Rua, G.H., 1991. The synflorescence of Poaceae. Beitr. Biol.
Pflanz. 66, 297–311.
Camus, A., 1930. Graminees nouvelles de Madagascar. Bol. Soc. Bot. France 77, 638–
641.
Christin, P.A., Salamin, N., Savolainen, V., Duvall, M.R., Besnard, G., 2007. C4
photosynthesis evolved in grasses via parallel adaptive genetic changes. Curr.
Biol. 17, 1241–1247.
Christin, P.A., Besnard, G., Samaritani, E., Duvall, M.R., Hodkinson, T.R., Savolainen,
V., Salamin, N., 2008. Oligocene CO2 decline promoted C4 photosynthesis in
grasses. Curr. Biol. 18, 37–43.
Christin, P.A., Petitpierre, B., Salamin, N., Buchi, L., Besnard, G., 2009. Evolution of C4
phosphoenolpyruvate carboxykinase in grasses, from genotype to phenotype.
Mol. Biol. Evol. 26, 357–365.
Cialdella, A.M., Giussani, L.M., Aagesen, L., Zuloaga, F.O., Morrone, O., 2007. A
phylogeny of Piptochaethium based on a combined analysis including trnL-F,
rpl16 and morphology. Syst. Bot. 32, 545–559.
Clayton, W.D., 1972. Gramineae, vol. III, part 2. In: Hepper, F.N. (Ed.), Flora of West
Tropical Africa, second ed. Crown Agents for Oversea Governments and
Administrations, London, pp. 277–574.
Clayton, W.D., 1980. Some new African Grasses. Kew Bull. 34, 557–560.
Clayton, W.D., Renvoize, S.A., 1982. Gramineae, part 3. In: Polhill, R.M. (Ed.), Flora
Tropical East Africa. Royal Botanic Gardens, Kew, pp. 451–898.
Clayton, W.D., Renvoize, S.A., 1986. Genera Graminum. Kew Bull. Addit. Ser. 13,
256–285.
Dengler, N.G., Nelson, T., 1999. Leaf structure and development in C4 plants. In:
Sage, R.F., Monson, R.K. (Eds.), C4 Plant Biology. Academic Press, London, pp.
133–164.
Doust, A.N., Kellogg, E.A., 2002. Inflorescence diversification in the panicoid ‘‘bristle
grass’’ clade (Paniceae, Poaceae): evidence from molecular phylogenies and
developmental morphology. Am. J. Bot. 89, 1203–1222.
Doust, A.N., Penly, A.M., Jacobs, S.W.L., Kellogg, E.A., 2007. Congruence, conflict, and
polyploidization shown by nuclear and chloroplast markers in the
monophyletic ‘‘bristle clade” (Paniceae, Panicoideae, Poaceae). Syst. Bot. 32,
531–544.
Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochem. Bull. 19, 11–15.
Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and
high throughput. Nucleic Acids Res. 32, 1792–1797.
Ellis, R.P., 1977. Distribution of the Kranz syndrome in the Southern African
Eragrostoideae and Panicoideae according to bundle sheath anatomy and
cytology. Agroplantae 9, 73–110.
Ellis, R.P., 1988. Leaf anatomy and systematics of Panicum (Poaceae: Panicoideae) in
Southern Africa. Monogr. Syst. Bot. Mo. Bot. Gard. 25, 129–156.
Farris, J.S., Albert, V.A., Källersjö, M., Lipscomb, D., Kluge, A.G., 1996. Parsimony
jackknifing outperforms neighbor-joining. Cladistics 10, 315–319.
Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39, 783–791.
Gallavotti, A., Zhao, Q., Kyozuka, J., Meeley, R.B., Ritter, M.K., Doebley, J.F., Pe, M.E.,
Schmidt, R.J., 2004. The role of barren stalk1 in the architecture of maize. Nature
432, 630–635.
Giussani, L.M., Cota-Sánchez, J.H., Zuloaga, F.O., Kellogg, E.A., 2001. A molecular
phylogeny of the grass subfamily Panicoideae (Poaceae) shows multiple origins
of C4 photosynthesis. Am. J. Bot. 88, 1993–2012.
Goloboff, P.A., Farris, J.S., Nixon, K., 2008. TNT, a free program for phylogenetics
analysis. Cladistics 24, 774–786.
Goméz-Martínez, R., Culham, A., 2000. Phylogeny of the subfamily Panicoideae with
emphasis on the tribe Paniceae: evidence from the trnL-F cpDNA Region. In:
Jacobs, S.W., Everett, J. (Eds.), Grasses: Systematics and Evolution. CSIRO
Publishing, Collingwood, pp. 136–140.
Grass Phylogeny Working Group (GPWG), 2001. Phylogeny and subfamilial
classification of the grasses (Poaceae). Ann. Mo. Bot. Gard. 88, 373–457.
Gutiérrez, M., Gracen, V.E., Edwards, G.E., 1974. Biochemical and cytological
relationship in C4 plants. Planta 119, 279–300.
Gutiérrez, M., Edwards, G.E., Brown, W.V., 1976. PEP carboxykinase containing
species in the Brachiaria group of the subfamily Panicoideae. Biochem. Syst.
Ecol. 4, 47–49.
Hall, T.A., 1999. Bioedit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.
Hattersley, P.W., 1984. Characterization of C4 type leaf anatomy in grasses
(Poaceae). Mesophyll: bundle sheath area ratios. Ann. Bot. 53, 163–179.
Hattersley, P.W., 1987. Variations in photosynthetic pathway. In: Soderstrom, T.R.,
Hilu, K.W., Campbell, C.S., Barkworth, M.E. (Eds.), Grass Systematics and
Evolution. Smithsonian Institution Press, Washington, DC, pp. 49–64.
368
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
Hattersley, P.W., Watson, L., 1992. Diversification of photosynthesis. In: Chapman,
G.P. (Ed.), Grass Evolution and Domestication. Cambridge University Press,
London, pp. 38–116.
Hitchcock, A.S., Chase, A., 1910. The North American species of Panicum. Contr. U.S.
Natl. Herb. 15, 1–136.
Hitchcock, A.S., 1951. Manual of the grasses of the United States. U.S.D.A. Misc. Publ.
200, 1–1051.
Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes. Bayesian inference of phylogenetic
trees. Bioinformatics 17, 754–755.
Ibrahim, D.G., Burke, T., Ripley, B.S., Osborne, C.P., 2009. A molecular phylogeny of
the genus Alloteropsis (Panicoideae, Poaceae) suggest an evolutionary reversion
from C4 to C3 photosynthesis. Ann. Bot. 103, 127–136.
Ikeda-Kawakatsu, K., Yasuno, N., Oikawa, T., Iida, S., Nagato, Y., Maekawa, M.,
Kyozuka, J., 2009. Expression level of aberrant panicle organization1 determines
rice inflorescence form through control of cell proliferation in the meristem.
Plant Physiol. 150, 736–747.
Jordan, W.C., Courtney, W.M., Neigel, E.J., 1996. Low levels of intraspecific genetic
variation at rapidly evolving chloroplast DNA locus in North American
duckwoods (Lemnaceae). Am. J. Bot. 83, 430–439.
Kelchner, S.A., Clark, L., 1997. Molecular evolution and phylogenetic utility of the
chloroplast rpl16 intron in Chusquea and the Bambusoideae (Poaceae). Mol.
Phylogenet. Evol. 8, 385–397.
Kelchner, S.A., 2000. The evolution of non-coding chloroplast DNA and its
application in plant systematics. Ann. Mo. Bot. Gard. 87, 482–498.
Kellogg, E.A., 2007. Floral displays: genetic control of grass inflorescences. Curr.
Opin. Plant Biol. 10, 26–31.
Linder, C.R., Rieseberg, L.H., 2004. Reconstructing patterns of reticulate evolution in
plants. Am. J. Bot. 91, 1700–1708.
Liu, Q., Zhao, N.X., Hao, G., 2005. Inflorescence structures and evolution in subfamily
Chloridoideae (Gramineae). Plant Syst. Evol. 251, 183–198.
Liu, Q., Peterson, P.M., Columbus, J.T., Xhao, N., Hao, G., Zhang, D., 2007.
Inflorescence diversification in the ‘‘finger millet clade” (Chloridoideae:
Pocaceae): a comparison of molecular phylogeny and developmental
morphology. Am. J. Bot. 94, 1230–1247.
McBreen, K., Lockhart, P.J., 2006. Reconstructing reticulate evolutionary histories of
plants. Trends Plant Sci. 11, 398–404.
McSteen, P., 2006. Branching out: the ramosa pathway and the evolution of grass
inflorescence morphology. Plant Cell 18, 518–522.
Mendes, D.V., Boldrini, K.R., Mendes-Bonato, A.B., Pagliarini, M.S., Valle, C.B., 2006.
Cytological evidence of natural hybridization in Brachiaria brizantha. Bot. J. Linn.
Soc. 150, 441–446.
Morrone, O., Zuloaga, F.O., 1992. Revisión de las especies sudamericanas nativas e
introducidas de los géneros Brachiaria y Urochloa (Poaceae: Panicoideae:
Paniceae). Darwiniana 31, 43–109.
Morrone, O., Zuloaga, F.O., 1993. Sinópsis del género Urochloa (Poaceae:
Panicoideae: Paniceae) para México y América Central. Darwiniana 32, 59–75.
Morrone, O., Hunziker, J.H., Zuloaga, F.O., Escobar, A., 1995. Números cromosómicos
en Paniceae sudamericanas (Poaceae: Panicoideae). Darwiniana 3, 53–60.
Morrone, O., Zuloaga, F.O., Arriaga, M.O., Pozner, R., Aliscioni, S., 1998. Revisión
sistemática y análisis cladístico del género Chaetium (Poaceae: Panicoideae:
Paniceae). Ann. Mo. Bot. Gard. 85, 404–424.
Murray, M.G., Thompson, W.F., 1980. Rapid isolation of high molecular weight plant
DNA. Nucleic Acids Res. 8, 4321–4325.
Nadeem Ahsan, S.M., Vahidy, A.A., Ali, S.I., 1994. Chromosome numbers and
incidence of polyploidy in Panicoideae (Poaceae) from Pakistan. Ann. Mo. Bot.
Gard. 81, 775–783.
Newton, M.A., Raftery, A.E., 1994. Approximate Bayesian inference by the weighted
likelihood bootstrap (with discussion). J. Roy. Stat. Soc. B 56, 3–48.
Nguyen, T.Q., 1966. Notulae criticae de Gramineis florae vietnamensis, 1. Novosti.
Sist. Vyssh. Rast. 3, 10–14.
Olmstead, R.G., Sweere, J.A., 1994. Combining data in phylogenetics systematics –
an empirical approach using three molecular data sets in the Solanaceae. Syst.
Biol. 43, 467–481.
Pagel, M., 1994. Detecting correlated evolution on phylogenies: a general method
for comparative analysis of discrete characters. Proc. R. Soc. Lond. B 225, 37–45.
Pagel, M., 1997. Inferring evolutionary processes from phylogenies. Zool. Scr. 26,
331–348.
Pagel, M., 1999. The maximum likelihood approach to reconstructing ancestral
character states of discrete characters on phylogenies. Syst. Biol. 48, 612–622.
Pagel, M., Meade, A., Barker, D., 2004. Bayesian estimation of ancestral character
states on phylogenies. Syst. Biol. 53, 673–684.
Pagel, M., Meade, A., 2006. Bayesian analysis of correlated evolution of discrete
characters by reversible-jump Markov chain Monte Carlo. Am. Nat. 167, 808–
825.
Pagel, M., Meade, A., 2007. BayesTraits version 1.0 computer package. Software
available from: <http://www.evolution.reading.ac.uk/BayesTraits.html>.
Parodi, L.R., 1969. Estudios sistemáticos sobre las Gramineae-Paniceae Argentinas y
Uruguayas. Darwiniana 15, 65–111.
Pensiero, J.F., Vegetti, A.C., 2001. Inflorescence typology in Setaria P. Beauv.
(Poaceae, Paniceae). Feddes Repert. 112, 371–385.
Penteado, M.I.O., Rodrigues, I.F., Valle, C.B., Seixas, M.A.C., Esteves, A., 2000.
Determinação de poliploidia e avaliação da quantidade de DNA total em
diferentes espécies de gênero Brachiaria. Campo Grande, Embrapa Gado de
Corte. pp. 1–19.
Perreta, M.C., Ramos, J.C., Vegetti, A.C., 2009. Development and structure of the
grass inflorescence. Bot. Rev. 75, 377–396.
Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution.
Bioinformatics 14, 817–818.
Prendergast, H.D.V., Hattersley, P.W., Stone, N.E., 1987. New structural/biochemical
associations in leaf blades on C4 grasses (Poaceae). Aust. J. Plant Physiol. 14,
403–420.
Rambaut, A., Drummond, A.J., 2007. Tracer v1.4. Available from: <http://
beast.bio.ed.ac.uk/Tracer>.
Reinheimer, R., Pozner, R., Vegetti, A.C., 2005. Inflorescence, spikelet, and floral
development in Panicum maximum and Urochloa plantaginea (Poaceae). Am. J.
Bot. 92, 565–575.
Reinheimer, R., Vegetti, A.C., 2008. Inflorescence diversity and evolution in the PCK
clade (Poaceae: Panicoideae: Paniceae). Plant Syst. Evol. 275, 133–167.
Reinheimer, R., Zuloaga, F.O., Vegetti, A.C., Pozner, R., 2009. Diversification of the
inflorescence development in the PCK clade (Poaceae: Panicoideae: Paniceae).
Am. J. Bot. 96, 549–564.
Renvoize, S.A., Clayton, W.D., Kabuye, C.H.S., 1996. Morphology, taxonomy and
natural distribution of Brachiaria (Trin.) Griseb. In: Miles, J.W., Maas, B.L., Do
Valle, C.B. (Eds.), Brachiaria: Biology, Agronomy and Improvement. CIAT
Publication 259, Cali, pp. 1–15.
Renvoize, S.A., 1998. Gramíneas de Bolivia. The Royal Botanical Garden, Kew.
Risso-Pascotto, C., Pagliarini, M.S., Valle, C.B., 2005. Meiotic behavior in interspecific
hybrids between Brachiaria ruziziensis and Brachiaria brizantha (Poaceae).
Euphytica 145, 155–159.
Risso-Pascotto, C., Pagliarini, M.S., Valle, C.B., 2006. A new basic chromosome
number for the genus Brachiaria (Trin.) Griseb. (Poaceae: Panicoideae:
Paniceae). Genet. Resour. Crop Evol. 53, 7–10.
Rua, G.H., 1993. The synflorescence of Paspalidium rarum (Poaceae) and an
alternative hypothesis about the evolution of some poaceous inflorescences.
Aust. Syst. Bot. 6, 261–267.
Rua, G.H., 1996. The inflorescences of Paspalum (Poaceae, Paniceae): the Quadrifaria
group and the evolutionary pathway towards the fully homogenized, truncated
common type. Plant Syst. Evol. 201, 199–209.
Salariato, D.L., Morrone, O., Zuloaga, F.O., 2008. Ornamentación del antecio superior
en Urochloa y géneros vecinos (Poaceae: Panicoideae: Paniceae): su valor
sistemático. Darwiniana 46, 335–355.
Salariato, D.L., Giussani, L.M., Morrone, O., Zuloaga, F.O., 2009. Rupichloa, a new
genus segregated from Urochloa (Poaceae) based on morphological and
molecular data. Taxon 58, 381–391.
Saghai-Maroof, M.A., Soliman, K.M., Jorgensen, R.A., Allard, R.W., 1984. Ribosomal
DNA spacer-length polymorphisms in barley: Mendelian inheritance,
chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA
81, 8014–8018.
Shaw, R.B., Smeins, F.E., 1979. Epidermal characteristics of the callus in Eriochloa
(Poaceae). Am. J. Bot. 66, 907–913.
Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with
applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116.
Simon, B.K., Jacobs, S.W.L., 2003. Megathyrsus, a new generic name for Panicum
subgenus Megathyrsus. Austrobaileya 6, 571–574.
Simmons, M.P., Ochoterena, H., 2000. Gaps as characters in sequence-based
phylogenetic analyses. Syst. Biol. 49, 369–381.
Spies, J.J., Du Plessis, H., 1986. Miscellaneous notes. Chromomosome studies on
African plants: 2. Bothalia 16, 269–270.
Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic
analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–
2690.
Stamatakis, A., Hoover, P., Rougemont, J., 2008. A rapid bootstrap algorithm for the
RAxML web-servers. Syst. Biol. 57, 758–771.
Stapf, O., 1934. Gramineae (Maydeae-Paniceae). In: Prain, D. (Ed.), Flora of Tropical
Africa, vol. IX. L. Reeve & Co., Kent, pp. 422–606.
StatSoft, Inc., 2004. STATISTICA for Windows. StatSoft, Inc., Tulsa, OK.
Suchard, M.A., Weiss, R.E., Sinsheimer, J.S., 2001. Bayesian selection of continuoustime Markov chain evolutionary models. Mol. Biol. Evol. 18, 1001–1013.
Swallen, J.R., 1950. New grasses from Mexico, Central America and Surinam. Contr.
U.S. Natl. Herb. 29, 415.
Swallen, J.R., 1966. Notes on grasses. Phytologia 14, 65–98.
Swofford, D.L., 2003. PAUP*: Phylogenetic Analysis using Parsimony (*and Other
Methods), Version 4. Sinauer Associates, Sunderland, MA.
Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for
amplification of three non-coding regions of chloroplast DNA. Plant. Mol. Biol.
17, 1105–1109.
Taguchi-Shiobara, F., Yuan, Z., Hake, S., Jackson, D., 2001. The fascinated ear2 gene
encodes a leucine-rich repeat receptor-like protein that regulates shoot
meristem proliferation in maize. Genes Dev. 15, 2755–2766.
Torres González, A.M., Morton, C.M., 2005. Molecular and morphological
phylogenetic analysis of Brachiaria and Urochloa (Poaceae). Mol. Phylogenet.
Evol. 37, 36–44.
Troll, W., 1964. Die Infloreszenzen, Typologie und Stellung imAufbau des
Vegetationskörpers 1. Gustav Fischer, Jena.
Troll, W., 1969. Botanischer Teil. In: Kommission für biologische Forschung (Ed.),
Akademie der Wissenschaften und der Literatur. Bericht. Jb., Mainz, pp. 88–105.
Ueno, O., Sentoku, N., 2006. Comparison of leaf structure and photosynthetic
characteristics of C3 and C4 Alloteropsis semialata subspecies. Plant Cell Environ.
29, 257–268.
Valle, C.B., Savidan, Y., 1996. Genetics, cytogenetics, and reproductive biology of
Brachiaria. In: Miles, J.W., Maas, B.L., Do Valle, C.B. (Eds.), Brachiaria: Biology,
Agronomy and Improvement. CIAT Publication 259, Cali, pp. 1–15. 147–163.
D.L. Salariato et al. / Molecular Phylogenetics and Evolution 56 (2010) 355–369
Vegetti, A.C., 2000. Typology of synflorescence in Oryzeae (Poaceae). Phyton
(Austria) 40, 71–88.
Vegetti, A.C., Anton, A.M., 2000. The grass inflorescence. In: Jacobs, S.W.L., Everett, J.
(Eds.), Grasses: Systematics and Evolution. CSIRO, Melbourne, pp. 29–31.
Veldkamp, J.F., 1996. Brachiaria, Urochloa (Gramineae-Paniceae) in Malaysia.
Blumea 41, 413–437.
Veldkamp, J.F., 2004. Miscellaneous notes on mainly Southeast Asian gramineae.
Reinwardtia 12, 135–140.
Vicentini, A., Barber, J.C., Aliscioni, S.S., Giussani, L.M., Kellogg, E.A., 2008. The age of
the grasses and clusters of origins of C4 photosynthesis. Glob. Change Biol. 14,
2963–2977.
Vollbrecht, E., Reiser, L., Hake, S., 2000. Shoot meristem size is dependent on inbred
background and presence of the maize homeobox gene, knotted1. Development
127, 3161–3172.
Vollbrecht, E., Springer, P.S., Goh, L., Buckler, E.S., Martienssen, R., 2005. Architecture
of the floral branch systems in maize and related grasses. Nature 436, 1119–1126.
Voznesenskaya, E.V., Franceschi, V.R., Chuong, S.D.X., Edwards, G.E., 2006.
Functional characterization of phospoenolpiruvate carboxikinase-type C4 leaf
369
anatomy: immuno-cytochemical and ultrastructure analyses. Ann. Bot. 98, 77–
91.
Weberling, F., 1992. Primitive Blütestände bei primitiven Angiospermen? Stapfiana
28, 29–51.
Weberling, F., Müller-Doblies, U., Müller-Doblies, D., Rua, G.H., 1997. Hacia una
terminología descriptiva y morfológico-comparativa para inflorescencias
complejas. Bol. Soc. Argent. Bot. 32, 171–184.
Webster, R.D., 1987. The Australian Paniceae (Poaceae). J. Cramer, Stuttgart.
Zhang, W., 2000. Phylogeny of the grass family (Poaceae) from rpl16 intron
sequence data. Mol. Phylogenet. Evol. 15, 385–397.
Zizka, G., 1988. Revision der Melinideae Hitchcock (Poaceae, Panicoideae). Biblioth.
Bot. 138, 1–149.
Zuloaga, F.O., Morrone, O., 1996. Revisión de las especies americanas de Panicum
subgénero Panicum sección Panicum (Poaceae: Panicoideae: Paniceae). Ann. Mo.
Bot. Gard. 83, 200–280.
Zuloaga, F.O., Morrone, O., Davidse, G., Pennington, S.J., 2007. Classification
and biogeography of Panicoideae (Poaceae) in the New World. Aliso 23, 503–
529.
liliana giussani