The N-Terminal Region of Cucumber Mosaic Virus 2a Protein Is Involved in the Systemic Infection in Brassica juncea
Abstract
:1. Introduction
2. Results
2.1. CMV-Co4 and CMV-Co6 Systemically Infect B. juncea
2.2. RNA2 of CMV-Co6 Determines Systemic Infection in B. juncea
2.3. CMV 2a (but Not 2b) Protein Independently Determines Systemic Infection in B. juncea
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Virus Source and Mechanical Inoculation
4.3. RNA Extraction and RT-PCR
4.4. Infectious Clone Construction and In Vitro Transcription
4.5. Alignment Analysis
4.6. 2a Protein Structure Modeling
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Palukaitis, P.; Roossinck, M.J.; Dietzgen, R.G.; Francki, R.I. Cucumber mosaic virus. Adv. Virus Res. 1992, 41, 281–348. [Google Scholar] [CrossRef] [PubMed]
- Mochizuki, T.; Ohki, S.T. Cucumber mosaic virus: Viral genes as virulence determinants. Mol. Plant Pathol. 2012, 13, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Khaing, Y.Y.; Kobayashi, Y.; Takeshita, M. The 2b protein and C-terminal region of the 2a protein indispensably facilitate systemic movement of cucumber mosaic virus in radish with supplementary function by either the 3a or the coat protein. Virol. J. 2020, 17, 49. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-S.; Lee, S.-H.; Choi, H.-S.; Kim, M.-K.; Kwak, H.-R.; Kim, J.-S.; Nam, M.; Cho, J.-D.; Cho, I.-S.; Choi, G.-S. 2007–2011 characteristics of plant virus infections on crop samples submitted from agricultural places. Res. Plant Dis. 2012, 18, 277–289. [Google Scholar] [CrossRef]
- Jones, R.A.C. Plant virus ecology and epidemiology: Historical perspectives, recent progress and future prospects. Ann. Appl. Biol. 2014, 164, 320–347. [Google Scholar] [CrossRef]
- Lee, J.H.; Hong, J.S.; Ju, H.-J.; Park, D.H. Occurrence of viral diseases in field-cultivated pepper in Korea from 2006 to 2010. Korean J. Org. Agric. 2015, 23, 123–131. [Google Scholar] [CrossRef]
- Jeon, M.-K.; An, H.-J.; Lim, C.-k.; Kim, S.-A.; Jang, Y.-J.; Chung, S.-W. Incidence of Viral Disease on Purple Passion Fruit (Passiflora edulis). J. Agric. Life Sci. 2022, 56, 29–35. [Google Scholar] [CrossRef]
- Kim, S.H.; Oh, S.; Oh, T.-K.; Park, J.S.; Kim, S.C.; Kim, S.H.; Kim, Y.S.; Hong, J.K.; Sim, S.-Y.; Park, K.S. Genetic diversity of tomato-infecting Tomato yellow leaf curl virus (TYLCV) isolates in Korea. Virus Genes 2011, 42, 117–127. [Google Scholar] [CrossRef] [PubMed]
- Jacquemond, M. Cucumber mosaic virus. Adv. Virus Res. 2012, 84, 439–504. [Google Scholar] [CrossRef]
- Palukaitis, P.; García-Arenal, F. Cucumoviruses. Adv. Virus Res. 2003, 62, 241–323. [Google Scholar] [CrossRef]
- Roossinck, M.J. Cucumber mosaic virus, a model for RNA virus evolution. Mol. Plant Pathol. 2001, 2, 59–63. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Pendon, J.A.; Li, F.; Li, W.-X.; Ding, S.-W. Suppression of antiviral silencing by cucumber mosaic virus 2b protein in Arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering RNAs. Plant Cell 2007, 19, 2053–2063. [Google Scholar] [CrossRef] [PubMed]
- Soards, A.J.; Murphy, A.M.; Palukaitis, P.; Carr, J.P. Virulence and differential local and systemic spread of Cucumber mosaic virus in tobacco are affected by the CMV 2b protein. Mol. Plant-Microbe Interact. 2002, 15, 647–653. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.-W.; Anderson, B.J.; Haase, H.R.; Symons, R.H. New overlapping gene encoded by the cucumber mosaic virus genome. Virology 1994, 198, 593–601. [Google Scholar] [CrossRef]
- Canto, T.; Prior, D.A.; Hellwald, K.-H.; Oparka, K.J.; Palukaitis, P. Characterization of Cucumber mosaic virus. Virology 1997, 237, 237–248. [Google Scholar] [CrossRef] [PubMed]
- Jeon, Y.-W.; Hong, J.-S.; Lee, S.-Y.; Ryu, K.-H.; Choi, J.-K. Characterization of an Isolate of Cucumber mosaic virus Isolated from Canna generalis Bailey. Res. Plant Dis. 2006, 12, 298–302. [Google Scholar] [CrossRef]
- Takeshita, M.; Takanami, Y. Defective long-distance transport of Cucumber mosaic virus in radish is efficiently complemented by Turnip mosaic virus. J. Gen. Plant Pathol. 2000, 66, 254–257. [Google Scholar] [CrossRef]
- Kim, Y.-T.; Kim, B.-K.; Park, K.-Y. Antimutagenic and anticancer effects of leaf mustard and leaf mustard kimchi. Prev. Nutr. Food Sci. 2007, 12, 84–88. [Google Scholar] [CrossRef]
- Kwon, H.-Y.; Choi, S.-I.; Park, H.-I.; Choi, S.-H.; Sim, W.-S.; Yeo, J.-H.; Cho, J.-H.; Lee, O.-H. Comparative analysis of the nutritional components and antioxidant activities of different Brassica juncea cultivars. Foods 2020, 9, 840. [Google Scholar] [CrossRef]
- Lee, J.-H.; Jin, Y.H.; Park, Y.K.; Yun, S.J.; Mah, J.-H. Formation of biogenic amines in Pa (green onion) kimchi and Gat (mustard leaf) kimchi. Foods 2019, 8, 109. [Google Scholar] [CrossRef]
- Faan, H.; Ko, C. A preliminary study on the mosaic virus of crucifers in the vicinity of Canton. Acta Phytopathol. Sincia 1957, 3, 155–168. [Google Scholar]
- Diyansah, B.; Aini, L.Q.; Hadiastono, T. The effect of PGPR (plant growth promoting rhizobacteria) Pseudomonas fluorescens and Bacillus subtilis on leaf mustard plant (Brassica juncea L.) infected by TuMv (Turnip Mosaic Virus). J. Trop. Plant Prot. 2012, 1, 30–38. [Google Scholar]
- Nyalugwe, E.P.; Barbetti, M.J.; Jones, R.A. Studies on resistance phenotypes to Turnip mosaic virus in five species of Brassicaceae, and identification of a virus resistance gene in Brassica juncea. Eur. J. Plant Pathol. 2015, 141, 647–666. [Google Scholar] [CrossRef]
- Nyalugwe, E.P.; Barbetti, M.J.; Jones, R.A. Strain specificity of Turnip mosaic virus resistance gene TuRBJU 01 in Brassica juncea. Eur. J. Plant Pathol. 2016, 145, 209–213. [Google Scholar] [CrossRef]
- Pound, G.S.; Walker, J. Strains of cucumber mosaic virus pathogenic on crucifers. J. Agric. Res. 1949, 77, 1. [Google Scholar]
- Wong, S.-M.; Thio, S.S.-C.; Shintaku, M.H.; Palukaitis, P. The rate of cell-to-cell movement in squash of cucumber mosaic virus is affected by sequences of the capsid protein. Mol. Plant-Microbe Interact. 1999, 12, 628–632. [Google Scholar] [CrossRef]
- Hong, J.; Ohnishi, S.; Masuta, C.; Choi, J.; Ryu, K. Infection of soybean by Cucumber mosaic virus as determined by viral movement protein. Arch. Virol. 2007, 152, 321–328. [Google Scholar] [CrossRef] [PubMed]
- Bol, J.F. Role of capsid proteins. Plant Virol. Protoc. Viral Seq. Protein Funct. 2008, 451, 21–31. [Google Scholar] [CrossRef]
- Hayashi, T. Fate of tobacco mosaic virus after entering the host cell. Jpn. J. Microbiol. 1974, 18, 279–286. [Google Scholar] [CrossRef]
- Suzuki, M.; Kuwata, S.; Kataoka, J.; Masuta, C.; Nitta, N.; Takanami, Y. Functional analysis of deletion mutants of cucumber mosaic virus RNA3 using an in vitro transcription system. Virology 1991, 183, 106–113. [Google Scholar] [CrossRef]
- Ryu, K.H.; Kim, C.-H.; Palukaitis, P. The coat protein of cucumber mosaic virus is a host range determinant for infection of maize. Mol. Plant-Microbe Interact. 1998, 11, 351–357. [Google Scholar] [CrossRef]
- Kang, B.-C.; Yeam, I.; Jahn, M.M. Genetics of plant virus resistance. Annu. Rev. Phytopathol. 2005, 43, 581–621. [Google Scholar] [CrossRef] [PubMed]
- Kobori, T.; Miyagawa, M.; Nishioka, K.; Ohki, S.T.; Osaki, T. Amino acid 129 of Cucumber mosaic virus coat protein determines local symptom expression and systemic movement in Tetragonia expansa, Momordica charantia and Physalis floridana. J. Gen. Plant Pathol. 2002, 68, 81–88. [Google Scholar] [CrossRef]
- Nemes, K.; Gellért, Á.; Bóka, K.; Vági, P.; Salánki, K. Symptom recovery is affected by Cucumber mosaic virus coat protein phosphorylation. Virology 2019, 536, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Ng, J.C.; Liu, S.; Perry, K.L. Cucumber mosaic virus mutants with altered physical properties and defective in aphid vector transmission. Virology 2000, 276, 395–403. [Google Scholar] [CrossRef] [PubMed]
- Takeshita, M.; Suzuki, M.; Kuwata, S.; Takanami, Y. Involvement of cucumber mosaic cucumovirus RNA2 and RNA3 in viral systemic spread in radish plant. Arch. Virol. 1998, 143, 1109–1117. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Ryu, K.H.; Palukaitis, P. Cucumber mosaic virus-plant interactions: Identification of 3a protein sequences affecting infectivity, cell-to-cell movement, and long-distance movement. Mol. Plant-Microbe Interact. 2001, 14, 378–385. [Google Scholar] [CrossRef] [PubMed]
- Shi, B.-J.; Palukaitis, P.; Symons, R.H. Differential virulence by strains of Cucumber mosaic virus is mediated by the 2b gene. Mol. Plant-Microbe Interact. 2002, 15, 947–955. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.K.; Palukaitis, P.; Min, B.E.; Lee, M.Y.; Choi, J.K.; Ryu, K.H. Cucumber mosaic virus 2a polymerase and 3a movement proteins independently affect both virus movement and the timing of symptom development in zucchini squash. J. Gen. Virol. 2005, 86, 1213–1222. [Google Scholar] [CrossRef]
- Tao, X.; Zhou, X.; Li, G.; Yu, J. The pathogenicity on legumes of Cucumber mosaic virus was determined by 243 nucleotides on 2a polymerase gene of viral RNA2. Chin. Sci. Bull. 2002, 47, 748–750. [Google Scholar] [CrossRef]
- Kim, S.H.; Palukaitis, P.; Park, Y.I. Phosphorylation of cucumber mosaic virus RNA polymerase 2a protein inhibits formation of replicase complex. EMBO J. 2002, 21, 2292–2300. [Google Scholar] [CrossRef] [PubMed]
- Chapdelaine, Y.; Kirk, D.; Karsies, A.; Hohn, T.; Leclerc, D. Mutation of capsid protein phosphorylation sites abolishes cauliflower mosaic virus infectivity. J. Virol. 2002, 76, 11748–11752. [Google Scholar] [CrossRef] [PubMed]
- Hoover, H.S.; Wang, J.C.-Y.; Middleton, S.; Ni, P.; Zlotnick, A.; Vaughan, R.C.; Kao, C.C. Phosphorylation of the brome mosaic virus capsid regulates the timing of viral infection. J. Virol. 2016, 90, 7748–7760. [Google Scholar] [CrossRef] [PubMed]
- Hung, C.-J.; Huang, Y.-W.; Liou, M.-R.; Lee, Y.-C.; Lin, N.-S.; Meng, M.; Tsai, C.-H.; Hu, C.-C.; Hsu, Y.-H. Phosphorylation of coat protein by protein kinase CK2 regulates cell-to-cell movement of Bamboo mosaic virus through modulating RNA binding. Mol. Plant-Microbe Interact. 2014, 27, 1211–1225. [Google Scholar] [CrossRef]
- Lohmus, A.; Hafren, A.; Mäkinen, K. Coat protein regulation by CK2, CPIP, HSP70, and CHIP is required for potato virus A replication and coat protein accumulation. J. Virol. 2017, 91, e01316-16. [Google Scholar] [CrossRef]
- Nemes, K.; Gellért, Á.; Almási, A.; Vági, P.; Sáray, R.; Kádár, K.; Salánki, K. Phosphorylation regulates the subcellular localization of Cucumber Mosaic Virus 2b protein. Sci. Rep. 2017, 7, 13444. [Google Scholar] [CrossRef] [PubMed]
- Spence, N.; Phiri, N.; Hughes, S.; Mwaniki, A.; Simons, S.; Oduor, G.; Chacha, D.; Kuria, A.; Ndirangu, S.; Kibata, G. Economic impact of Turnip mosaic virus, Cauliflower mosaic virus and Beet mosaic virus in three Kenyan vegetables. Plant Pathol. 2007, 56, 317–323. [Google Scholar] [CrossRef]
- Chung, B.N.; San Choi, K.; Ahn, J.J.; Joa, J.H.; Do, K.S.; Park, K.-S. Effects of temperature on systemic infection and symptom expression of Turnip mosaic virus in Chinese cabbage (Brassica campestris). Plant Pathol. J. 2015, 31, 363. [Google Scholar] [CrossRef]
- Siddiqui, S.A.; Valkonen, J.P.; Rajamäki, M.-L.; Lehto, K. The 2b silencing suppressor of a mild strain of Cucumber mosaic virus alone is sufficient for synergistic interaction with Tobacco mosaic virus and induction of severe leaf malformation in 2b-transgenic tobacco plants. Mol. Plant-Microbe Interact. 2011, 24, 685–693. [Google Scholar] [CrossRef]
- Wang, Y.; Gaba, V.; Yang, J.; Palukaitis, P.; Gal-On, A. Characterization of synergy between Cucumber mosaic virus and potyviruses in cucurbit hosts. Phytopathology 2002, 92, 51–58. [Google Scholar] [CrossRef]
- Chen, Y.-J.; Zhang, J.; Liu, J.; Deng, X.-G.; Zhang, P.; Zhu, T.; Chen, L.-J.; Bao, W.-K.; Xi, D.-H.; Lin, H.-H. The capsid protein p38 of turnip crinkle virus is associated with the suppression of cucumber mosaic virus in Arabidopsis thaliana co-infected with cucumber mosaic virus and turnip crinkle virus. Virology 2014, 462, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Takeshita, M.; Koizumi, E.; Noguchi, M.; Sueda, K.; Shimura, H.; Ishikawa, N.; Matsuura, H.; Ohshima, K.; Natsuaki, T.; Kuwata, S. Infection dynamics in viral spread and interference under the synergism between Cucumber mosaic virus and Turnip mosaic virus. Mol. Plant-Microbe Interact. 2012, 25, 18–27. [Google Scholar] [CrossRef] [PubMed]
- Sano, Y.; Kojima, M. Increase in cucumber mosaic virus concentration in Japanese radish plants co-infected with turnip mosaic virus. Jpn. J. Phytopathol. 1989, 55, 296–302. [Google Scholar] [CrossRef]
- Rhee, S.-J.; Hong, J.-S.; Choi, J.-K.; Kim, E.-J.; Lee, G.-P. Characterization of an Isolate of Cucumber mosaic virus from Raphanus sativus L. Res. Plant Dis. 2011, 17, 211–215. [Google Scholar] [CrossRef]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Zeng, F.; Zhang, S.; Hao, Z.; Duan, S.; Meng, Y.; Li, P.; Dong, J.; Lin, Y. Efficient strategy for introducing large and multiple changes in plasmid DNA. Sci. Rep. 2018, 8, 1714. [Google Scholar] [CrossRef]
- Guex, N.; Peitsch, M.C. SWISS-MODEL and the Swiss-Pdb Viewer: An environment for comparative protein modeling. Electrophoresis 1997, 18, 2714–2723. [Google Scholar] [CrossRef]
Host | Symptoms * | |||
---|---|---|---|---|
CMV-Co6 | CMV-Co4 | CMV-Fny | CMV-Rs1 | |
Brassica juncea | +/Chl | +/Chl | nt/− | −/− |
Capsicum annuum cv. Cheong-yang | +/M | +/M | +/M | +/M |
Chenopodium quinoa | L/− | L/− | L/− | L/− |
Cucumis sativus | +/M | +/M | +/M | +/M |
Cucurbita pepo | L/N, sM | L/N, sM | +/M | +/M |
Nicotiana benthamiana | +/M | +/M | +/M | +/M |
N. tabacum cv. Xanthi nc | +/M | +/M | +/M | +/M |
N. rustica | +/M | WRS/N, R | +/M | +/M |
Raphanus sativus cv. Seoho-gold | +/M | +/+ | nt/− | −/− |
R. sativus cv. Yeong-dong | +/M | +/+ | nt/− | −/− |
Vigna unguiculata | L/− | L/− | L/− | L/− |
Host | Pathogenicity | |||||||
---|---|---|---|---|---|---|---|---|
CMV-Co6 | CMV-Rs1 | R/R/6 | R/6/R | R/6/6 | R/R/R6cp | R/6/R6cp | R/6Rns/R6cp | |
Brassica juncea | +/Chl a | −/− | −/− | +/+ | +/+ | −/− | +/+ | +/+ |
Raphanus sativus cv. Seoho-gold | +/M | −/− | +/− | −/− | +/+ | +/− | +/+ | +/− |
R. sativus cv. Yeong-dong | +/M | −/− | +/− | −/− | +/+ | +/− | +/+ | +/− |
Protein | Amino Acid Position | Virus | ||
---|---|---|---|---|
CMV-Co6 | CMV-Rs1 | CMV-Co4 | ||
2a | 160 * | Gly | Ser | Gly |
214 * | Ala | Val | Ala | |
313 | Thr | Ile | Ile | |
449 | Val | Asp | Asp | |
805 * | Ile | Val | Ile | |
832 * | Leu | Pro | Leu |
Primer Name | Nucleotide Sequence (5′ → 3′) * |
---|---|
CMV RNA1 5′ end BamHI T7 | CGGGATCCtaatacgactcactataGTTTTATTTACAAGAGCGTACG |
CMV RNA2 5′ end BamHI T7 | CGGGATCCtaatacgactcactataGTTTATTYWCAAGAGCGTA |
CMV RNA3 5′ end BamHI T7 | CGGGATCCtaatacgactcactataGTAATCTTACACTGTGTGTGTG |
CMV RNA1 and 2 3′ end PstI | GCCTGCAGTGGTCTCCTTTGGAAGCCC |
CMV RNA3 3′ end SphI | GCCATGCTGGTCTCCTTTGGAAGCCC |
CMV RNA2 2374 5′ | AGTTCAGGGTTGAGCGTGT |
CMV-CP-5′ | ATGGACAAATCTGAATCAACCAG |
CMV-CP-3′ | TCAGACTGGGAGCACTCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, T.-S.; Min, D.-J.; Park, J.-S.; Hong, J.-S. The N-Terminal Region of Cucumber Mosaic Virus 2a Protein Is Involved in the Systemic Infection in Brassica juncea. Plants 2024, 13, 1001. https://doi.org/10.3390/plants13071001
Park T-S, Min D-J, Park J-S, Hong J-S. The N-Terminal Region of Cucumber Mosaic Virus 2a Protein Is Involved in the Systemic Infection in Brassica juncea. Plants. 2024; 13(7):1001. https://doi.org/10.3390/plants13071001
Chicago/Turabian StylePark, Tae-Seon, Dong-Joo Min, Ji-Soo Park, and Jin-Sung Hong. 2024. "The N-Terminal Region of Cucumber Mosaic Virus 2a Protein Is Involved in the Systemic Infection in Brassica juncea" Plants 13, no. 7: 1001. https://doi.org/10.3390/plants13071001