Asia Pacific AsPac J. Mol. Journal Biol. Biotechnol., of MolecularVol. Biology 11 (1), and2003 Biotechnology, 2003 Vol. 11 (1) : 9-35 Phylogeny of Fabaceae 9 Molecular Phylogeny of Fabaceae based on rbcL sequence data: With special emphasis on the tribe Mimoseae (Mimosoideae) Shaida Fariza Sulaiman1*, Alastair Culham2 and Jeffrey B. Harborne2 1 School of Biological Sciences, University of Science Malaysia, 11800, Minden, Penang 2 Department of Botany, Plant Science Laboratories, The University of Reading, Whiteknights, P. O. Box 221, Reading RG6 6AS, U. K Received 1August 2002 / Accepted 20 December 2002 Abstract. A cladistic analysis using rbcL sequence data of 23 species from 16 genera of Mimoseae with two species of Acacieae, four species of Ingeae, one species of Parkieae, 11 species of Caesalpinioideae and five species of Papilionoideae as the study group, and two species of Polygalaceae as the outgroup taxa, was conducted. The result although very preliminary provides very informative findings which confirm the paraphyly of the tribe Mimoseae and support the monophyly of the genera Mimosa, Entada and Neptunia; and the Adenanthera group. The results also support the monophyly of the subfamily Mimosoideae and the subfamily Papilionoideae and confirms the paraphyly of the Caesalpinioideae. Kanaloa kahoolawensis (a species from Hawaii which is still uncertain for the placement) is found to be closely related to Leucaena leucocephala in Leucaena group. Keywords. Mimoseae; Mimosoideae; rbcL; DNA sequencing; phylogeny; cladistic analysis INTRODUCTION There still exists much uncertainty regarding the intuitive generic relationships among the members of the tribe Mimoseae. This tribe belongs to the subfamily Mimosoideae comprising 38 genera with more than 720 species. The species are distributed throughout the Old and New World tropics and sub-tropics with the highest diversity and distribution in South America and tropical Africa. This tribe is distinguished from the other four tribes of Mimosoideae by the possession of valvate sepals in the bud and ten or fewer free stamens (sometimes joined at the base). The generic classification of the tribe is based on the fruits, flowers, pollen types and the arrangements of stigma (Bentham, 1875; Lewis and Elias, 1981). Lewis and Elias (1981) have proposed 12 groups of genera in the Mimoseae and suggested only very vaguely relationship. Some of the genera have a degree of similarity to the Dimorphandra group of Caesalpinieae, which is generally believed to be basal to the Mimosoideae (Polhill, 1994). A preliminary cladistic analysis of the entire family, based mainly on floral, vegetative and reproductive morphological characters has been conducted by Tucker and Douglas (1994) on 33 genera. The results support the monophyly of the family and of the subfamilies Papilionoideae and Mimosoideae. They suggested that the subfamily Caesalpinioideae does not form a clade since there is a lack of apomorphic characters. However, some of its tribes are monophyletic. Chappill (1995), in her cladistic analysis of the Fabaceae using a data set gathered from the literature also confirmed the monophyly of the Fabaceae, Papilionoideae and Mimosoideae but suggested that Caesalpinioideae is a paraphyletic group basal to the subfamily Mimosoideae. Chappill’s analysis was more comprehensive in its representation of the family’s subfamilies and tribes compared with that of Tucker and Douglas. Instead of having only morphological characters, a few phytochemical and molecular characters were also included in her analysis. Both of these cladistic analyses were acknowledged by their authors to be quite preliminary, and the relationship hypothesised from the two studies differed dramatically. Their cladograms revealed a contrasting model of relationships between the 12 groups of Mimoseae with that of Lewis and *Author for Correspondence. Mailing address: School of Biological Sciences, University of Science Malaysia,11800, Minden, Penang. Tel: 604-6533888 ext. 4056; Fax: 6046565125; Email: Shaida@usm.my 10 AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Elias (1981) and the tribe Mimoseae does not form a monophyletic group, but is paraphyletic to Mimozygantheae, Parkieae, Acacieae and Ingeae. However, their sampling of taxa from the tribe Mimoseae is inadequate for confirming the generic level relationships. An additional extensive analysis of the Fabaceae is therefore needed. Sequences of the chloroplast gene ribulose-1-5biphosphate carboxylase/oxygenase (rbcL) have been used to produce phylogenetic hypotheses within Fabaceae by Doyle (1995), Kass and Wink (1996) and Doyle et al. (1997). The results also agreed with the earlier finding that Mimosoideae and Papilionoideae are derived from Caesalpinioideae. Their samples for subfamily Mimosoideae are inadequate to suggest the tribal or generic relationships and to prove the monophyly of this subfamily. Only eight species of Mimosoideae representing four tribes were used in the legume phylogenetic analysis of Kass and Wink (1996). Doyle et al. (1995; 1997) have only used the complete rbcL sequence of Parkia roxburghii as the Mimosoideae representative for their legume phylogenetic analysis. Therefore, more rbcL sequencing data from this subfamily is needed to provide a better insight into legume phylogeny. The purpose of the present study is to improve the phylogeny of Fabaceae by including more taxa from the tribe Mimoseae and to analyse whether the phylogeny inferred from rbcL nucleotide sequence data correlates with the Lewis and Elias (1981) intuitive inter-generic relationships. MATERIALS AND METHODS Plant material. Twenty-three species from 16 genera of Mimoseae were used in this survey. The sources of plant material are listed in Table 1a. RbcL sequence data of eight taxa from the subfamily Mimosoideae, eleven taxa from the subfamily Caesalpinioideae, three taxa from the subfamily Papilionoideae and an outgroup taxon, Polygala chamaebuxus (Polygalaceae) were kindly provided by Professor M. Wink as detailed in Table 1. Sequences of Sophora japonica and Anagyris foetida (both Papilionoideae), and Securidaca diversifolia (Polygalaceae) were taken from National Center for Biotechnology Information (NCBI) GenBank (Table 1). Polygala chamaebuxus and Securidaca diversifolia from Polygalaceae were used as outgroups since these two genera formed the sister groups to Fabaceae in a molecular survey of seed plants (Chase et al., 1993). DNA Extraction. Total genomic DNA was extracted from fresh leaves using a CTAB mini-DNA extraction (Doyle and Doyle, 1987). Several modifications were done to these buffers for extracting the herbarium material, i.e., (1) increasing the percentage of the CTAB buffer to 3% or 4%, (2) replacing the CTAB buffer and 5% sarkosyl with the same amount of ‘Nucleon phytopure’ plant DNA extraction reagents and Phylogeny of Fabaceae Table 1. National Center for Biotechnology (NCBI) GenBank database accession number of the taxa used for the analysis Species Acacia cavenia M. Molina Acacia farnesiana (L.) Willd. Albizia julibrissin Durazz. Albizia lophantha (Willd.) Benth. Albizia saman F. Muell. Anagyris foetida L. Bauhinia candicans Vog. Brownea ariza Benth. Caesalpinia pulcherrima (L.) Sw. Cassia senna L. Ceratonia siliqua L. Cercis siliquastrum L. Delonix regia (Hook.) Raf. Genista cinerea (Vill.) DC. Gleditsia triacanthos L. Gymnocladus dioica (L.) Koch. Lathyrus tuberosus L. Lupinus polyphyllus Lindley Mimosa polycarpa Kunth var. spegazzinii Pirotta Parkia roxburghii G. Don Parkinsonia aculeata L. Pithecellobium mexicanum Rose Polygala chamaebuxus L. Securidaca diversifolia (L.) S. F. Blake Sophora japonica L. Tamarindus indica L. Accession No Z 701 45 Z 701 46 Z 701 47 Z 701 48 Z 701 49 Z 701 22 Z 701 61 Z 701 58 Z 701 53 Z 701 55 Z 701 65 Z 701 64 Z 701 56 Z 700 94 Z 701 29 Z 701 66 Z 701 72 Z 701 52 Z 701 51 Z 701 52 Z 701 57 Z 701 50 Z 701 76 G 294864 Z 701 42 Z 701 60 adding to the ground sample, and (3) 4µl of 10mM mercaptoethanol was added to the 200µl of lysis buffer. PCR protocol. The following reagents were mixed into a sterile 0.5ml eppendorf tube to a final volume of 50µl containing 2-50 ng genomic DNA, 0.5µM of rbcL 1F primer and 0.5µM of rbcL 1460R, 5mM of each dNTP, 4mM MgCl2, 16mM (NH4)2SO4, 67mM Tris-HCl, 0.1% Tween-20 and 1.5 unit of Taq DNA polymerase (5u.µl-1). Primers used for PCR flank the beginning and the end of the rbcL gene: 1F is the forward primer (5’ ATGTCACCACAAACAGAAAC 3’) and 1460R is the reverse primer (3’ TCCTTTTAGTAAAAGATTGGGCCGAG 5’) used. The reaction mixture was overlaid with 80µl of sterile mineral oil to prevent evaporation of the reagents during thermal cycling. The tubes were placed in the Hybaid Omnigene thermal cycler and the following program was set for 30 cycles: 94oC for 1minute (for DNA denaturation), 50oC for 0.5 minutes (for DNA annealing), 72oC for 1minute (for DNA synthesis). The reaction was maintained at 4oC on completion. The PCR products were visualised on a 1.5% agarose gel (0.45g agarose + 30ml TAE buffer) and then cleaned with a AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Phylogeny of Fabaceae 11 Table 1a. Source of plant material Species Source of seeds Accession number Voucher number deposited at RNG Adenanthera pavonina L. The Hong Kong Herbarium, Agriculture & Fisheries Department, Kowloon Jardin La oratava puerto Dela Cruz, Teneiife Jardin Botanique Dela Ville 1418 SFS01 35 SFS02 2111 SFS03 Jodrell Glass Seed, Royal Botanic Gardens, Kew Zambia 1983-4631 SFS04 SL004 SL004 Zambia Oxford Forest Institute, Forest Genetics Seed University of Reading seed collection Oxford Forest Institute, Forest Genetics Seed Jardin Botanico Da Universidade Lisboa, Portugal Univ.Sains Malaysia seed collection Jardi Botanic (E 17300 Blanes, Girono) Northern Botanical Garden, Province Ferrara Italy (Istituto ed Orto Botanico dell’ Universito degli Studi Ingeniero Agronomo, Buenos Aires Oxford Forestry Institute, Forest Genetics Seed Zambia SL022 2/93 SL022 SFS05 143/92 SFS06 SFS09 194 SFS10 101 102 2489 367/92 194 SFS12 SFS14 SFS15 SFS16 455 49/83 SFS19 SFS20 SL003 SL003 Dichrostacys cinerea (L.) Wright & Arn. Desmanthus illinoensis (Michx.) MacMill. ex B. L. Rob & Fernald Elephantorrhiza burkei Benth. Entada abyssinica Steud. ex A. Rich. Entada camerunensis Villiers Gagnebina pterocarpa (Lam.) Baill. Leucaena leucocephala (Lam.) de Wit. Microlobius foetidus (Jacq.) M. Sousa & G. Andrade subsp. foetidus Mimosa acanthocarpa (Willd.) Poir. Mimosa pigra L. Mimosa pudica L. Neptunia monosperma F. Muell. Neptunia plena (L.) Benth. Parapitadenia rigida (Benth.) Brenan Prosopis juliflora (Sw.) DC. Pseudoprosopis fischeri (Taub.) Harms Specimen Collector Place Date Herbarium Entada dolichorrhachis Brenan Entada gigas (L.) Fawc. & Rendle Fillaeopsis discophora Harms Kanaloa kahoolawensis Lorence & K. R. Wood Tetrapleura tetraptera (Schumach & Thonn.) Taub. S. Lungu 023 S. Lungu 028 M.T. Testu 9434 Lorence 7379 L. Toussaint 140 Zambia Zambia Gaboon Kahoolawei, Hawaii Congo 28/10/92 4/12/92 1/9/74 14/5/93 12/1/48 RNG RNG FHO BH FHO Qiaquick (Qiagen, Germany) PCR cleaning column and filter kit. The products were eluted in 50µl of autoclaved ‘Nanopure’ water. Cycle sequencing. Cycle sequencing was performed using the Perkin Elmer ready reaction mix and following the protocol provided except that half volume reactions (i.e. 10µl) were used. For each reaction, the following reagents were mixed in a labelled sterile 0.5ml eppendorf tube. 4µl of ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Mix, 1.5-4.4µl of template PCR product, 1.6µl Primer (1µM) and water to a final volume of 10µl. Listed in Table 2 are ten types of primers that were used for cycle sequencing in this survey. To obtain the overlapping sequences at least four primers were used for each taxon studied. The tubes were placed in a PTC-100 Programmable Thermal cycler (PeltierEffect Cycling) and the following programme was set for 25 cycles: 96oC for 30 seconds; 50oC for 15 seconds and 60oC for 4 minutes. Sequencing. DNA sequencing was performed using an Applied Bio-Systems 373A Automated Sequencer. Raw sequence data were edited using the LaserGene package. All the sequences from different forward and reverse primers used were complimented together and edited in the SeqMan II programme by including the complete rbcL sequence of Mimosa polycarpa var. spegazzinii (accession no. Z70151; Kass and Wink, 1996). The sequence was confirmed by reading AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 the complementary strand or by obtaining overlapping reads on the same strand with different primers. Consensus sequences were saved using the Edit Sequence programme. The MegAlign programme was used to align all the sequences for the analysis. All assemblies and initial alignments were manually optimised. Sequencing analysis. All the sequencing analyses were performed using PAUP 4.0.0d55 (Swofford, unpublished). Maximum likehood settings were applied to determine the base frequencies. Phylogenetic trees were reconstructed using the phylogeny program for maximum parsimony and the neighbour-joining pairwise distance method. Sequence from positions 35 to 1420 was used in the analysis. The maximum parsimony analysis was performed using the heuristic search option set for MULPARS, TBR branch-swapping and ACCTRAN (Accelerated transformation). Additional analyses of 100 replicates were performed via random taxon addition using the stepwise-addition option. Strict consensus and 50% majority rule trees were generated from the set of most parsimonious trees. In the neighbour-joining analyses, genetic distances were calculated based on the Tamura-Nei algorithm (Tamura and Nei, 1993) which corrects for any bias in transition/ transversions and uneven codon usage. The Jackknife method (Farris et al., 1996) as executed in PAUP 4.0.0d55 with 50% deletion and 10,000 replicates (with fast stepwise addition) was performed to obtain estimates of the robustness of the clades. RESULTS AND DISCUSSION RbcL sequences. No deletions, insertions or inversions of nucleotides or other sequence elements were observed. The full rbcL sequence alignment is documented in Table 3. Base composition and mode of substitution. Figure 1 shows the average percentages of nucleotide composition in total and at first, second and third codon positions. The standard deviations of all the means are less than 0.5%. Thymidine is frequent in the third codon position and infrequent in the first position. The opposite can be seen for guanine being high in the first position and underrepresented in the third codon position. The second position is less variable and the most constrained. These findings are typical observations in the chloroplast genome, and the bias of guanine and thymidine is more obvious in the gene involved in photosynthesis that other cpDNA (Kass and Wink, 1995). Of 1386 included characters, 427 positions were variable and of these, 234 are parsimony informative positions, leaving 183 which are autapomorphies. Among the parsimony informative characters, 149 are third codon position, 53 are first codon position and 32 are second codon position. These data agreed with the previous rbcL studies that the third codon Phylogeny of Fabaceae Table 2. Primers used for the cycle sequencing Primer Sequences 1F SS1F 674F SS674F SS961F M305R SS722R 724R M1010R 1460R ATGTCACCACAAACAGAAAC ATGTCACCACAAACAGAGAC TTTATAAATCRCARGCTGAAAC TTWWTAAAGCACAGGCYGAAAC TCTGGTGGAGATCATATTCA GCTACATAAGCAATATATTG CTTCVCATGTACGYGCAGTAGC TCGCATGTACCYGCAGTTGC CCTTCAAGTTTACCTAC TCCTTTTAGTAAAAGATTGGGCCGAG position is more variable. The higher variability of the third codon position provides valuable information for comparing taxa at the family level (Olmstead and Palmer, 1994). The distribution of parsimony informative variable sites within the rbcL gene used in this analysis is shown in Figure 2 and Figure 3. Considerable variation is detected in all regions including the start and the end of the sequences. The number of substitutions inferred for each nucleotide position was calculated over the most parsimonious trees using PAUP 4.0.0d55. Substitutions occur fairly uniformly across the gene (Figure 3). The highest number of steps is 11 found in sites 284 and 673. Transitions are nucleotide substitutions between pyrimidine or purine bases, i. e. from A ⇔ G or C ⇔ T whereas transversions are changes from pyrimidines to purines and vice versa, i. e. G ⇔ C, G ⇔ T and A ⇔ C, A ⇔ T. Figure 4 indicates that the transition from C ⇔ T has the highest percentage and transversion from A ⇔ G has the lowest percentage. There is a strong bias of transition and transversion ratios for the third codon position. The first codon position has average ratio of 0.765, 0.522 for the second codon position and 1.713 for the third position. Nucleotide composition (%) 12 45,000 40,000 35,000 30,000 25,000 20,000 15,000 10,000 5,000 0 A C G T Total First Second Third Codon position Figure 1. Codon-specific average % nucleotide composition in the rbcL genes used in the analysis. AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Phylogeny of Fabaceae 13 12 1351 - 1400 10 1251 - 1300 8 Steps 1151 - 1200 1051 - 1100 6 951 - 1000 4 851 - 900 2 751 - 800 0 651 - 700 1 551 - 600 98 195 292 389 486 583 680 777 874 971 1068 1165 1262 1359 Site Figure 3. Histogram showing distribution of parsimony informative nucleotide changes and the number of steps as calculated from the most parsimonious trees derived from rbcL sequence data. 451 - 500 351 - 400 251 - 300 151 - 200 51 - 100 0 2 4 6 8 10 12 14 Figure 2. Parsimony informative variability within 50 nucleotide positions of rbcL gene used in the analysis. Genetic distances (nucleotide substitutions). Table 4 indicates the pairwise relative genetic distances between the 48 rbcL sequences used in the analysis calculated based on the Tamura-Nei algorithm (Tamura and Nei, 1993). Distances within genera in the subfamily Mimosoideae range from 0 to 4.156%, while distances between genera in the tribe Mimoseae are from 1.096 to 6.478%. The pairwise genetic distances between the two genera are dependent not only on the parsimony informative variations but also on the parsimony uninformative variations or the autapomorphic characters. The genetic distances might be informative only for infra-generic relationships but no clear distinction can be made between the generic, tribal and subfamilial levels. The taxa with more unique variation in the nucleotide substitutions have greater genetic distances. Entada camerunensis gave the highest percentage distances among the members of tribe Mimoseae, while the lowest was observed in Elephantorrhiza burkei. Elephantorrhiza burkei showed less unique variation compared with the majority nucleotide substitutions. Phylogenetic analyses. Analysis of the data resulted in 32 most parsimonious trees of 865 steps, a consistency index (CI) of 0.6023, and a retention index (RI) of 0.6607. The results obtained support the monophyly of Mimosoideae and Papilionoideae, while subfamily Caesalpinioideae, as previously suggested, is a paraphyletic grade of basal elements. The jackknife value of 100% supports the Fabaceae clade from the outgroup taxa, the monophyly of Papilionoideae has 84% jackknife support and the Mimosoideae has 83% support. The representative for subfamily Papilionoideae are reduced to only five taxa the monophyly of this subfamily has been previously discuss by other authors such as Kass and Wink (1996) and Doyle (1995). The synapomorphy of the Papilionoideae clade with consistency index = 1.00 is at the position 1293 while the synapomorphies of Mimosoideae clade are the base substi- tutions from T ⇒ C at position 1260 and from G ⇒ A at position 1389 (both with consistency index = 1.00). From the strict consensus tree (Figure 5), Cercideae, Detarieae and Amherstieae are basal to Mimosoideae. Doyle (1995) and Kass and Wink (1996) found that these three tribes diverged nearly at the same time. The sequence data show that they are distinct groups of the Fabaceae, separated from the tribes Caesalpinieae and Cassieae by high distance values and high jackknife values. Moreover, there is still no clear evidence either way to transfer these three tribes into a distinct subfamily or to consider them as part of the Caesalpinioideae (Kass and Wink, 1996). Polhill et al. (1981) suggested that subfamily Mimosoideae was derived from the Dimorphandra group of Caesalpinieae. In the rbcL tree of Doyle et al. (1997), the genus Erythrophleum from Dimorphandra group was strongly supported as sister to Parkia, the only Mimosoideae used in their analysis. The results obtained agree with the earlier findings (Polhill et al., 1981; Tucker and Douglas, 1994; Chappill, 1995; Kass and Wink, 1996; Doyle et al., 1997) that subfamily Mimosoideae is derived from the tribes Caesalpinieae and Cassieae. Both of these Caesalpinioideae tribes do not represent monophyletic groups since they are found in several clades in this analysis. The interesting finding of this survey is the paraphyly of the tribe Mimoseae. This finding agrees with Chappill (1995) in her legume cladistic analysis using largely morphological data where she found that Mimoseae does not form a monophyletic group, but is paraphyletic with Parkieae, Acacieae and Ingeae. The majority rule tree supports the position of Ingeae and Acacieae as more derived tribes from a basal Mimoseae as suggested by Elias (1981) and confirmed by Chappill in her cladogram. As indicated in Figure 5, the strict consensus of the rbcL sequence data do not provide a good resolution for the relationships of the clade containing the Fillaeopsis, Prosopis, Leucaena, Dichrostachys and Piptadenia groups of Mimoseae, Acacieae, Ingeae and Parkieae. The taxa in this clade share many derived characters, for example at positions 528 and 1065 (Table 3). This analysis supports the monophyly of the Adenanthera 14 Table 3. The rbcL sequence alignment used in the cladistic analysis Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... ********** ********** ********** ********** ********** ********** ********** .......... ********** ********** ********** ********** ********** ********** ********** ********** ********** ********** .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ********** ********** .......... ********** .......A.. .......... .......A.. ********** ********** ********** ********** ********** ********** ********** .......A.. ********** ********** ********** ********** ********** ********** ********** ********** ********** ********** .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ********** ********** .......... ********** T......... T......... T......... ****A..... ********.. ***....... *****..... ********** ******.... ****...... T......... ********** ***....... ********** ********** ********** ********** ********** ********.. *********. ********** T......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ******.... ******.... .........C *********. .......... .......... .......... C......... .....A.... .....A.... .....A...T ********** .....A.... .....A.... .......... ***..A.... .....A.... ********** *********. ******..A. ********** *....A.... .....A.... .....A.... .....A.... .....A.... .....A.... .....A.... .....A.... .....A.... .....A.... .....A.... .....A.... .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...A...... .......... ...A...... ....A..... .......... .......... .......... ...T...... .......... ********** .......... ...GA..... ********** .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....C..... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....C..... .......... .......... .......... .G.....C.. .G.....C.. .......... .......... .......... .......... ....C..... .C..C..... .......... .......... .......... .......... .......... .......... .......... ********** .......... .G..C..... ********** .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........C .......... A......... A......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ********.. .......... .......... **........ C......... .......... C......... ..GG...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....T.... .......... G......... G.....A... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...A...... ...A...... .......... ...T...... ...T...... ...A...... .........G .......... ...A...... ...A...... ...A...... ...A...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......A.. ...A...... .......... .......... .......... .......... .......... .......... .......... ...A...... .......A.. .......... .......... .......... .......... ...A...... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..T....... ..T....... .......... .......... .......... .........G .......... .......... ......T... .......... .......... .....G.... .....G.... .......... .......... .......... .......... .......... .......... .......... ..T......G .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... Phylogeny of Fabaceae ATGTCACCAC AAACAGAGAC GAAAGCAAGT GTTGGGTTCA AAGCTGGTGT TAAAGATTAT AAATTGACTT ATTATACTCC TGACTATGAA ACCAAAGATA AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 1-100 Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... G......... G......... .......... G......... .......... G......... G......... .......... G......... G......... .......... G......... G......... G......... .......... .......... G......... G......... G......... G......... G......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... A......... .......... .......... .......... .......... .......... .......... .......... .......... .......... A......... A......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... G......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....T.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .G........ .G........ .......... .......... .......... .......... .......... .......... .......... .......... .......A.. .......... .......... .......C.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......C.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........C .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........C .........C ......T... ......T... .......... .......... .......... .......G.. .........C .......G.C .......... .......... .......... .......... .......... .......... .......... .......... .......... ........G. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........G. .......... .......... .......... .......... ........G. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........G. ....A..... ....A..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......A... ......A... .......... .......... .......... .......... .......... .......... .G........ .G..G..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......C... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......C... ......C... .......... ......A... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....C..... .......... .......... .......... .......... .......... Phylogeny of Fabaceae CTGATATCTT GGCAGCATTC CGAGTAACTC CTCAACCTGG AGTTCCGCCT GAAGAAGCAG GTGCCGCGGT AGCTGCTGAA TCTTCTACTG GTACATGGAC AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 101-200 15 16 Table 3. The rbcL sequence alignment used in the cladistic analysis (continued) Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .G........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..G.....A. .......... .......... .......... .......... .......... .......... .......... ..T..C.... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..T..C.... .......... .......... .......... .......... .......... .....C.... .....C.... .......... .......... .....C.... .......... .......... ........A. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... ....T.A... ....T..... ....T..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......C.. .......C.. .......... .......... .......... .......... .......... .......C.. .......... .......... .......... .......... .......... ......C... .......... .......G.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......C... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......C... .......... .......... .........T .......... .......... ..T....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........C. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .T........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... ........C. .......... .......... .......... .......... .......... .......... .......... .......... ....T..... ....T..... .......... .....G.... .......T.. .......... .......... T.....T... .......... .......... .......... .......... .......... .......... .......... ......A... ......A... ......A... ......A... ......A... .......... .......... ......T... .......... .......... .......... .......... .........G .......... .......... .......... ....T..... ....T..... ....T..... ....T..... .......... .......... .......... .......... .......... A......... T......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......T... ......T... ......T... .......... .......... .......... .......... .......... .......... .......... .........A .......... .......... .......... C......... C......... .A........ .......... .......... C......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... C......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... C......... .......... .......... .......... .........A .........A .........A .......... .......... .......... .......... .........A ...G...... .........A ...C...... ...G...... ...G...... .........A .........A ...C...... ...G...... ...C...... ...G..G... .........A .........A .........A .......... .......... .........A .........A .........A .........A ...G...... .........A .........A ...G...... .........A ...C...... .......... .........A ...G...... .........A .........A .......... .......... ...G...... ...G...... .........A .G........ ...G...... ..G....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......C... .......... .......... .......... .......... .......... .......... .......... Phylogeny of Fabaceae AACTGTGTGG ACCGATGGGC TTACCAGTCT TGATCGTTAC AAAGGACGAT GCTACCACAT CGAGCCCGTT GCTGGAGAAG AAAATCAATT TATTGCTTAT AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 201-300 Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... ..GA...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....G.... .......... ........C. ........C. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .T........ .......... .......... .......... .......... ..C....... .......... .......... ..C....... .......... .T........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..C....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........C .......... .......... ......G... ......G... ......G... ......G... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...C...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..A....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..A....... ..A....... .......... ..A....... .....A.... .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......A.. .......A.. .......A.. .......A.. .......... .......... .......... .......... .......... .......... .......... .G........ .......... .......... .......... .......... .......... .......... .......... .T........ .T........ .......A.. .......A.. .......T.. ........C. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........A .........A .......... .......... .......... .........T .........T .........T .........T ......T... ......T... .......... .......... .........T .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...A...... .......... .......... .......... .......... .......T.. .......... .......... .......... ......A... .......... .......... .......... .......... ......T... .......... .......... ..T....... ..T....... ..T....... ..T....... ..T....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..T....... .......... .......... .......... .......... ......T... .......... .......... .......C.. .......... .......... .......... .......... .......... .......... ......T... ......T... .......... .......... .......... .......... Phylogeny of Fabaceae GTAGCTTATC CCTTAGACCT TTTTGAAGAA GGTTCTGTTA CTAACATGTT TACTTCCATT GTGGGTAATG TATTTGGGTT CAAGGCCCTG CGCGCTCTAC AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 301-400 17 18 Table 3. The rbcL sequence alignment used in the cladistic analysis (continued) Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......A.. .......A.. .......A.. .......A.. .......... .......... .......... .......A.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......A.. .......A.. .......... .......A.. ..T....... ..T....... .......... .C........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......G.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..C....... .......... .......... .......... .......... .......... ......T... ......T... ...A...... ......T... ......T... ......T... ......T... ...A..T... ......T... ......T... ......T... ......T... ......T... ......T... ....A..... ....A..... ......T.C. ......T... ......T... ......T... ......T... .......... ...A..T... ...AA..... ...A..T... ...A...... ...A..T... ...A..T... .......... ...A...... ...A...... ...A...... .......... ...AA..... ...A...... ...A...... ...AA..... ..C.....C. ..C...T.C. ..T....... ..T....... ..T....... ..T....... ..T....... ..T....... ..T....... ..T....... ..T....... ..T....... ..T....... .......... ..T....... ..T....... ..T....... ..T....... .......... ....A..... ..T.A..... ..T....... .......... .......... .......... .......... .......... ..T....... ..T....... ..T....... ..T....... ..T....... ...T...... .......... ..GT...... ...T...... ...T...... .......... .......... ...T...... .......... .......... .......... .......... ..GT...... ...T...... ...T...... ..GTG..... .......... ...T...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...T...... .......... .A........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........C ......G... .......... ......G... .......... .........C .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..T....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .T........ .......... .......... .......... .A........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......G... ......G... .......... .......... ......G... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........C .........C .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........T. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...T...... .......... .......... .......... .......... .......... ....T..... .......... .......... .......... ...T..T... .......... .......... .......... .......... .......... ...T...... ...T...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .A........ .......... ....T..G.. ....T..... .A........ .......... .......G.. .......... .......... ....T..... ....T..... ....T..T.. .......T.. ....T..... ....T..... ....T..A.. ....T..... ....T..... Phylogeny of Fabaceae GTCTGGAGGA TTTGCGAATC CCTCCTGCTT ATACTAAAAC TTTCCAAGGT CCGCCTCACG GCATCCAAGT TGAGAGAGAT AAATTGAACA AGTACGGCCG AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 401-500 Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. Foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......G.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... C......... C......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........A. .......... .......... .......... .......... .......... .......... .......... .......... ........C. ........C. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......A.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .A.....C.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......T... ......T... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......T.. .......... .......... .......... .......... .......... .....G.... .....G.... .....G.... .....G.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..T....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... .......... .......... .......... .......... ....T..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... ....T..... .......... .......... .......... .......... .......... .......... .......... .......... ....T...C. .......... ....T..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...G...... ...G...... ...G...... ...G...... ...G...... .......... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... ...G...... .......... .......... .......... .......... .......... .......... .......... .......... ...G...... ...G...... .......... .......... .......... .......... .......... .......... ...T...... ...T...... .......... .......... .......... .......... ........T. .......... .......... ........T. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........T. ........T. ........T. .....C..T. ........T. ........T. .......... .......... .......... .......... .......... .......... .......... ........A. .......... .......... .......... .......... .......... .......... .......... ........T. .......... ........A. .......... .......... ........T. .......... .......... .......... ........T. .......... .......... .......... C......... .......... .......... .......... .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .T........ .......... .......... .T........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....G..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .......... ......C... .......... .......... .......... .......... .......... .......... .......... Phylogeny of Fabaceae TCCCCTATTG GGATGTACTA TTAAACCTAA ATTGGGGTTA TCCGCTAAGA ATTACGGTAG AGCAGTTTAT GAATGTCTCC GCGGTGGACT TGATTTTACC AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 501-600 19 20 Table 3. The rbcL sequence alignment used in the cladistic analysis (continued) Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .T........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .A........ .A........ .......T.. .......... .......... .......... .......... .......... .......... .A........ .......... .......... .......... .......... .......T.. ....C..... ....C..... ....C..... ....C..... .A........ .A........ .A........ .A........ ....C..... ....C..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... T......... ...T...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........G. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....GC... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .....GC... .......... .......... .....GC... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....G..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........A .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....A.... .....A.... ..C...T... ..C....... ..C....... .......... ..C...T... .......... .......... .......... .......... .......... .......... .......... ..C...T... .......... .T....T... .T....T... ..C...T... ......T... ......T... ..C...T... ..C...T... ..C...T... ..C...T... ..C...T... ..C...T... ..C....... ..C....... ..C....... ..C....... .....A.... .......... .......... ..C....... ..C...T... .TC...T... .......... .......... .......... .......... .......... .CC....... ....C..... ..C....... .......... ..C....... .......... ..C....... .......... .......T.. .....T.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .TT....... .T........ .....T...T .T.....A.. .T........ .......T.. .T........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .T........ .......... .......... .......... .......... .......... .....G.... .....T.... .....T.... .......... .......... .......... .......... .......... .....T...T .......... .T...T.... ..C....... ..T....... .......... .......... .......... .....C.... .....T.... .....T.... .....T.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........C. ........C. .......... .......... .......... .....G.... .....G.... ........C. ........C. .......... .......... .......... ........G. .....G.... .....G.... Phylogeny of Fabaceae AAAGATGATG AGAATGTGAA TTCCCAACCA TTTATGCGTT GGAGAGACCG TTTCTTATTT TGTGCCGAAG CAATTTATAA AGCACAGGCC GAAACAGGTG AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 601-700 Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......G.. .......... .......... .......... .......... .......... G.....T.T. ....T..... ....T..... .......... .......... .......... ....G..... .......... ........A. .......... .......... .......... .........A .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... ....T..... .......... .......... .......... .......... .......... .......... .......G.. .......... .......... .......... .......... .......... .........C .........C .......... .......... .......... .......... .......... .......... .......... .......A.. .......A.. .......... .......... .......... .......... .......... .......... A......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... A......... .......... .......... .......... .......... .......... .......... .......... .......... .......... A......... .......... .......... A.....T... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .G........ .......... .......... .C........ .......... .......... .......... .......... .......... .......... .......C.. .......C.. .......... .......... .......... .......... .......... .......... .......... .......... .G........ .......... .......... .......... .......... .......... .......... .......... .G........ .G........ .......... .......... .G........ .......... .......... .G........ .G..C..... .G..C..... .......... ....T..... .......T.. ....T..... .......... .......... .......... .......... .......... ....T..... .......... T......... .C........ .......T.. .......... .......... ....T..... .......T.. .......... .......... .......... .......... T......... .......... .......... .......... .......... .......... .......... .......... .......... .......... T......... .......... .......... .......... .......... .......... G......... G......... .......... .......... .......... .......... .......... T......... .......... .......... ..G....... ....C..... .......T.. .......... .......... .......T.. .......... .......... .......... .......... .......... .......... .......A.. .......T.. .......... .......... ..G....... ...T...T.. .......... .......... .......... .......... .......... ..G....... ..G....... .......... .......... .......... ........G. .......... ..A....... .......... ..A....... ..G....... ..G....... .......... ..G....... ..A....... ..A....... ..A....... ..A....... ..A....... ..A....... ..A....... ..A....... C.A....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..A.G.G... ..A.G.G... .......... .......... .......... .......... .......... .......... .......... .......... ...C..G... ..A.G.G... ......G... ......G... ......G... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... .......... .......... .......... .......... .......... .......... .......... .......... ..C....... .......... .......... T......... T......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... TA........ .A........ .A........ .......... .......... .A........ GA.......A GA........ GA........ GA........ TA........ .A........ .A........ TA........ .A........ .A........ .......... ....C..... .......... .......... .......... .....C.... .......... .......... .......... .....C.... ....C...G. .......... .......... ....C...G. .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....C..... .......... .......... ..T....... .......... .......... .......... ....C..... .......... ..A....... ..A....... ..A....... ..A....... ..T....... .......... .......... .......... ..A....... ..A....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..A....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..A....... .......... .......... .......... .......... .......... .......... .......... .......... .......... Phylogeny of Fabaceae AAATCAAAGG GCATTACTTG AATGCTACTG CAGGTACATG CGAAGAAATG ATCAAAAGAG CTGTATTTGC CCGAGAATTG GGCGTTCCTA TCGTAATGCA AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 701-800 21 22 Table 3. The rbcL sequence alignment used in the cladistic analysis (continued) Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .C........ .C........ .......... .......... .......... .......... .......... .......... .......... .......... .......C.. .......C.. Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... C......... C......... .......... .......... .......... .......... .......... .......... .......... ......T... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......T... ......T... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........C. .......... .......... .......... .......... .......... .......... .......... .....A..G. .......... .......... ..G..C.... .......... .....T.... .......... .......... .......... .......... .......... .......... .......... .......... ..T....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....C..... ....C..... .......... .......... .......... .......... .......... .......... .......... ....C..... .......... .......... .......... .......... .......... ....T..... ....T..... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... ......C... ......C... .......... .......... .......... .......... .......... .......... .......... ......T..A .....C.... .....C.... .....C.... .......... .......... .......... .......... .......... .......... ...A.CT..A .....CT..A .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... T......... .......... .......... .......... .......... T......... .......... .......... .......... .......... .......... T......... .......... .......... .....C.... T......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... ....T..... ....T..... .......... .......... ....A..... ....A..... ....A..... ....A..... .......... .......... .......... .......... .......... .......... ....A..... .......... .......... .T........ .T........ .......... .......... .......... .......... .......... ....C..... ....A..... .......... .......... .......... .......... .......... .......... .......... C......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... T......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .....C.... .....C.... .....C.... .......... .......... .......... .......... .....C.... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .C........ .C........ .C........ .......... .......... .C........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .C........ .......... .......... .......... .......... .C........ .C........ .C........ .......... .......... .......... .......... .......... ..T....C.. ......CC.. .......C.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...GC..... .......... .......... .......... .......... .......... .......... .......... Phylogeny of Fabaceae TGACTACTTA ACAGGGGGAT TCACTGCAAA TACTAGCTTG GCTCATTATT GCCGGGATAA TGGTCTACTT CTTCATATCC ATCGTGCAAT GCATGCAGTT AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 801-900 Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... ...C...... ...C...... .......... .......... .......... .......... .......... .......T.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..T....... .......... .......... .......... .......... .......... .......... GT........ .T........ .......... .......... .......... .......... .......... T......... ....A..... ....A..... G......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .A..A..... .......... .......... .......... ........T. .......... .......... ....C...T. ........T. .......... .......... .......... .......... C......... ....C..... ....C..... C......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .........T .........T .......... .......... .......... .......... .......... .......... .......... ..C....... .......... .......... .......... ........C. ........C. .......... .......... .......... .......... .......... .......... ........C. .......... .......... .......... ..C....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .......... .......... .......... C......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........A. .......... .......... ......C... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........A ..C....... .......... .......... A...T...C. A.......C. .......... .......... .......... .......... .......... A......... A.......C. .......... A.......C. .......... .......... C......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... C......... .......... .......A.. .......... .......... .......... .......... .......... A........A .......... C......... C......... .......... C......... C......C.T .......C.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........C .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........G. ........G. .......... .......... .......... .......... .......G.. .......... .......... .......... .......... .......... .......... .A........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .C.C....G. .......... .......... ....C..... ....C..... .......... .......... .......... .......... .......... ......C..A .......... .........A .........A .........G .......... .......... ...C...... .......... ......G... ...C..G... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .T........ .......... .......... .......... .......... .......... .........T .........T ...C...... .......... .T........ T......... .......... .........T .T........ .......... .......... .......... .A........ .......... ......C... ...T..T... .......... .......... .......... ...C...... .......... ...T...... .......... ...T...... ......C... ......T... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........A. .......... .......... .......... .......... Phylogeny of Fabaceae ATCGATAGAC AGAAGAATCA TGGTATGCAC TTTCGTGTAC TAGCTAAAGC GTTACGTTTG TCTGGTGGAG ATCATATTCA CGCTGGTACC GTAGTAGGTA AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 901-1000 23 24 Table 3. The rbcL sequence alignment used in the cladistic analysis (continued) Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......G... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....G..... ....G..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .........G .........G .....C.C.C .....C.C.G .....C.C.C .........G .........G .....C.A.. .......... .......... .......... ..G....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........G .........G .........G .........G .........G .........G .........G .........G .......... .......... .........G .........G .........G .........G .........G A.....G..G .........G .........G .......... .......... .......... .......... .......... .........C .......... .......... .......... .........C .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..T....... .......... ..T....... .......... .C........ .C........ .C........ .......... .C.....GT. .C........ .C........ .C........ .......... .......... .......... .......... .......... ....C..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .C........ .C........ .......... .C........ .C........ .C........ .C........ .C........ .......... .......... .C........ .C........ .......... .......... .......... .......... .C........ .C........ .......... .......... .......... .......... .......... ...T...... .......... .......... .......... ....TC.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......G... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....T.G... .......... .......... ......G... .......... .......... .......... .......... .......... .......... ...C...... ...C...... .......... .......... .......... ..AT.GGGCA .......A.A .......... .......... .......A.. .......A.A .......A.A .......... .......... .......... .........A .......... .......... .......... .......A.. .......A.. .......A.A .......A.A .......A.A .......A.A .......A.A .......... .........A .......... .....G.... .....G...A .........A .........A .......... .........A .........A .........A .......... .......... .........A .........A .......A.A .......... .......... ....G..... .......... .......... .......... ....C..... ....CC.... ....C..... .......... .......... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... ....G..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .......... ..A....... .......... .......... .......... .......... .......... .......... .....C.... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .......... .......... .A....T... .........T .........T .......... .......... .......... .......... .......... ......C... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......A.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .T........ .......... .......... .......... .......... .......... .......... .......... .......... .......A.. .......A.. .......... .......... .......... ..A....... .......... .......... .......... .......... Phylogeny of Fabaceae AACTTGAAGG GGAAAGAGAA ATCACTTTAG GTTTTGTTGA TTTACTACGT GATGATTTTG TTGAAAAAGA TCGAAGCCGC GGTATTTATT TCACTCAGGA AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 1001-1100 Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .G........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......T... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......T... ......T... ......T... ......T... ......T... ......T... T......... A......... T......... .......... A.G....... A......... T......... .......... T......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........C. A.G....... A.G....... A.G....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....T.... .......... .......... .......... .......... .......... .......... .......... .....A.... .....A.... .....T.... .....A.... .....A.... T....A.... A....A.... AC...A.... .......... .......... .......... ..A.A..... .......... .......... .......... .......... .......... .......... .......... .......T.. .......T.. .......T.. .......... .......... ..T....... ..A.A..... ....A..T.. ....A..... ....A..... ....A..... ....A..... ..A.A..T.. ..A.A..T.. .......... .......... .......... .......... .......... ..T....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......T.. ..T....... ....T..... .......... .......... .......T.. ..T....... ..T.A..T.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T ......A... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........A .......... ......A... .......... .........C .......... .......... G.....T..A G........A .......... .......... .......... .......... .......... .........A .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .A........ .......... .......C.. .......C.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ...C...... .......... .......... .......... .......... .......... .......... .........G .........G .........G .......... .......... .........G .........G ...C.....G .........G .........G .........G .........G .........G .........G .........G .........G .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........A. ........T. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........C .......... .......... .......... .......... .......G.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .........C .........C ...T.....C .......... .......... Phylogeny of Fabaceae TTGGGTCTCT CTACCGGGTG TTCTGCCCGT TGCTTCGGGG GGTATTCACG TTTGGCATAT GCCTGCTCTT ACCGAGATCT TTGGAGATGA TTCCGTACTA AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 1101-1200 25 26 Table 3. The rbcL sequence alignment used in the cladistic analysis (continued) Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... ........T. .......... ........T. ........T. ........T. .......... .......... .......... .......... ......T... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........T. .......... ........C. ........T. ........T. ........T. ........T. ........T. ........T. .....T..T. ........T. ........T. ........C. ........T. ........T. ........T. ........T. ........T. .......... .......C.. .......... .......... .......... .......... ....G..... .......... .......... .......... .......... .......... .......... .......... .......C.. .......C.. .A........ ....G..... .......... .......... .......... .......... ....G..... .......... .......... .......... .......... .......... .......... .......... .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .A........ .......... .......... .......... .......... .......... .......... .T........ .A........ .......... .A........ .......... .A........ .......... .A........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......T... .......... .......... .......... ...A...... .......... .......... .......... ...A...... ...A...... .......... .......... .......... ...T...... ...A...... .......... .......... .......... .......... .......... .......... .......... ..A....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......T.. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... .......... .G..G..... .......... .T........ .......... .......... .......... ....T..... ....T..... ....T..... ....T..... ....A..... ....T..... ....T..... .......... .......... .......... .......... .......... ....T..... .......... .......... .......... .......... .......... .......... .......... .......... ....T..... .......... ....A..... .......... .......... .......... .......... .......... .......... .......... .......... ....A..... ....A..... .......... .......... ....T..... ....G..... ....G..... .......... ....C..... .......... .......... .......... ...CC..... .......... ....C..... .......... ....C..... .......... ....C..... ....A..... .......... .......... .......... .......... .......... .......... .......... .......... T......... .......... T......... T......... .......... .......... .......... .......... T......... .........T .........T .........T .........T .........T .........T .........T .........T .........T .........T T........T T........T .........T .........T .........T ......A..T .........T .........T .......... .......... .......... .......... .......... ......A... ......A... ......A... .......... .T........ ...A...... .........G ......T... .......... .......... ...T...... .......... .......... .......... ...A...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .....C.... .......... .......... .......... .......... .......... .......... .......... ........G. ........G. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .C........ .......... .......... .......... .......... .......... ..C....... ..C..A.... .......... .......... ..A..A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .G........ .......... .......... .......... .......... .......... .......... .......... .......... .......... .G........ .C........ .C........ .G........ .T........ .T........ ..A....... .......... .......... .......... .......... ...T...... .......... .......... .......... .......... .......... .......... .......... ......C... .......... .......... ....A..... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......A... ......A... ......A... .......... .......... ......A... ......A... ......A... ......A... ......A... ......A... ......A... ......A... ......A... .....GA... .....GA... .......... .......... .......... .......... .......... .C......A. .......... .......... .......... ........CT .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..A....... .......... .......... .......... .......... .......... .......... .......... ........A. ........A. ..A....... ..G....... ..G....... ..G....... .......... .......... Phylogeny of Fabaceae CAATTCGGGG GGGGAACTTT AGGGCACCCT TGGGGAAATG CACCCGGTGC CGTAGCTAAC CGAGTAGCTC TAGAAGCATG TGTACAGGCT CGTAATGAGG AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 1201-1300 Fillaeopsis discocarpa Adenanthera pavonina Tetrapleura tetraptera Pseudoprosopis fisheri Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Leucaena leucocephala Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Desmanthus illinoensis Neptunia monosperma Neptunia plena Prosopis juliflora Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii Acacia cavenia Acacia farnesiana Albizia julibrissin Albizia lophantha Albizia saman Pithecellobium mexicanum Parkia roxburghii Caesalpinia pulcherrima Delonix regia Genista cinerea Gleditsia triacanthos Gymnocladus dioica Parkinsonia aculeata Cassia senna Ceratonia siliqua Brownea ariza Tamarandus indica Bauhinia candicans Cercis siliquastrum Lupinus polyphyllus Anagyris foetida Sophora japonica Lathyrus tuberosus Polygala chamaebuxus Securidaca diversifolia .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ..A....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .G........ .G........ .......... ....A..... .......... .......... .......... .......... .........A .......... .......... .....C.... .....C...A .......... .........A .......... .......... .......... .......... .......... .......... ....A..... .......... ......C... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....TC.... .......... .......... .......... .......... .......... .......... .......... ......C... ......C... ....TC.... .......... .......... .......... .......... .......... .......... .......C.. .......... .......... .......... .......... .......... .......... .......... ...G...... ...G...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......C... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......C... ......C... .......... .......C.. .......... .......... .......... .......... .......... .......... .......... ......C... .......... ......C... .......... .......... .......... .......... .......... .......... .....A.... .......... ..G....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....C..... .......... .......... .......... .......... .......... ....C..C.. ....C..... ....C....C ....C..... ....C..... ....C..... ....C..... ....C...C. ....C..... ....C..... .......... .......... .......... .......... ..T....... ..T..T.... .......... .....A.... .......... .......... ..T....... .......... ...G...... .......... .......... .......... .......... .......... .......... .......... ..T....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....TC.... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....TC.... .......... ....GC.... A...TC.... .......... .......... .......... .......... .......... .......... .......... ....T..... .......... ....A..... .......... .......... ........C. .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ......TTA. .......TC. .......... .......... .......... .......... .......... .....A.... .....A.... .....A.... .......... .......... .......... .......... .....T.... .......... .......... .......... .......... .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .G..C..... .......... .......... .......... .......... .......... .......... .......... ....G..... ....G..... ..TC...... .......... .......... .......... .......... .....T.... .......... .......... .......... ...C...... .......... ...C...... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .........T .......... .......... .......... ..C....... ..T....... .......... C......... ..G....... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. ........G. .......... .........A .........A .........A .......... .....C.... .......... .......... .......... .......... C.....C... .....C.... .......... .......... ....T..... .......... .......... .......... .......... C......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .G........ .G........ .G........ .G........ .G........ .G........ .G........ .G........ .......... .......... .G........ .G........ .G........ .G........ .G........ .G........ .G........ .G........ Phylogeny of Fabaceae GACGTGATCT TGCTCGTGAG GGTAATGAAA TTATTCGTGA GGCTAGCAAA TGGAGTCCTG AATTAGCTGC TGCTTGTGAA GTATGGAAAG AAATCAAATT AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Species/ Sequence 1301-1400 27 4 5 6 7 8 9 10 11 12 13 14 15 16 0.03249 0.02123 0.02645 0.03169 0.05386 0.02495 0.02360 0.01901 0.04387 0.03704 0.04463 0.04462 0.04651 0.03414 0.03176 0.02240 0.03246 0.02347 0.03022 0.03852 0.03702 0.02720 0.02424 0.02424 0.02571 0.02346 0.02495 0.02496 0.02796 0.02498 0.02721 0.05723 0.02947 0.03099 0.02721 0.02570 0.02871 0.04555 0.04400 0.04477 0.03938 0.05715 0.04706 0.03158 0.07450 0.05882 0.06359 0.02497 0.02800 0.03934 0.05776 0.03248 0.02808 0.02423 0.05242 0.04392 0.05400 0.05468 0.05284 0.04333 0.04009 0.03694 0.04385 0.03325 0.04005 0.04776 0.04471 0.03630 0.03859 0.03859 0.03402 0.03173 0.03325 0.03325 0.03626 0.03026 0.03174 0.06368 0.03858 0.04080 0.03322 0.03021 0.03552 0.05341 0.05184 0.05246 0.04631 0.06503 0.05638 0.03856 0.08269 0.06285 0.06524 0.01531 0.02794 0.04541 0.01902 0.01541 0.00945 0.04233 0.03250 0.04232 0.04156 0.03949 0.03262 0.02950 0.02850 0.02725 0.02123 0.02950 0.03475 0.03323 0.02348 0.02497 0.02497 0.02051 0.01829 0.01977 0.01978 0.02424 0.01606 0.01753 0.05173 0.02421 0.02722 0.02050 0.01753 0.02123 0.03940 0.03787 0.04091 0.03174 0.05242 0.04240 0.02619 0.07355 0.05099 0.05803 0.03169 0.04846 0.02272 0.01763 0.01311 0.04234 0.03401 0.04310 0.04539 0.04182 0.03415 0.03102 0.03002 0.02871 0.01902 0.02946 0.03549 0.03173 0.02571 0.02572 0.02572 0.02422 0.02199 0.02347 0.02348 0.02648 0.01679 0.01975 0.05328 0.02795 0.03096 0.02272 0.01974 0.02346 0.04020 0.03866 0.04475 0.03252 0.05162 0.04472 0.03001 0.07687 0.05017 0.05254 0.03396 0.02495 0.02730 0.02420 0.04925 0.04385 0.04467 0.04307 0.04877 0.03717 0.03703 0.03602 0.03774 0.02944 0.03548 0.03774 0.03776 0.02794 0.03169 0.03169 0.03169 0.02943 0.03094 0.03094 0.03395 0.03169 0.03320 0.06181 0.03850 0.04003 0.03471 0.03320 0.03547 0.05241 0.05085 0.05239 0.04619 0.06408 0.05469 0.04155 0.08574 0.06510 0.07147 0.04156 0.03868 0.04158 0.06321 0.06401 0.06324 0.06324 0.06478 0.05956 0.05779 0.05965 0.05622 0.05076 0.05854 0.06402 0.06400 0.05386 0.05618 0.05618 0.05308 0.05078 0.05232 0.05232 0.05386 0.04922 0.05078 0.08323 0.05931 0.06091 0.05233 0.05079 0.05309 0.07273 0.07114 0.07192 0.06243 0.08397 0.07113 0.05660 0.10261 0.08406 0.08897 0.01388 0.01384 0.04082 0.03552 0.04235 0.04232 0.04177 0.03489 0.03101 0.02994 0.02869 0.02272 0.03247 0.03928 0.03776 0.02644 0.02796 0.02796 0.02495 0.02272 0.02421 0.02421 0.02571 0.02198 0.02347 0.05482 0.03170 0.03323 0.02497 0.02346 0.02571 0.04476 0.04322 0.04706 0.03630 0.05708 0.04547 0.03389 0.07858 0.05879 0.06277 0.01096 0.03794 0.03345 0.03793 0.04021 0.03953 0.03340 0.02811 0.02854 0.02737 0.01985 0.02816 0.03569 0.03413 0.02435 0.02360 0.02360 0.02210 0.01987 0.02136 0.02137 0.02287 0.01690 0.01839 0.05039 0.02658 0.02814 0.01988 0.01838 0.02061 0.04037 0.03883 0.04034 0.03117 0.05111 0.04186 0.02868 0.07316 0.05440 0.05837 0.03701 0.02875 0.03701 0.03851 0.03793 0.02810 0.02500 0.02467 0.02497 0.01605 0.02572 0.03096 0.02946 0.01975 0.02124 0.02124 0.01679 0.01458 0.01606 0.01606 0.01902 0.01238 0.01385 0.04943 0.02197 0.02497 0.01680 0.01384 0.01753 0.03562 0.03410 0.03863 0.02800 0.05011 0.03860 0.02467 0.07033 0.05024 0.05416 0.03247 0.04618 0.04845 0.04570 0.04329 0.04085 0.04233 0.04155 0.03324 0.04081 0.05001 0.04849 0.04005 0.04159 0.04159 0.03399 0.03171 0.03170 0.03323 0.03022 0.03932 0.04081 0.07058 0.04929 0.04849 0.04236 0.04082 0.04465 0.05713 0.05556 0.06424 0.05557 0.07371 0.06181 0.05023 0.09346 0.07547 0.07716 0.04693 0.04386 0.03715 0.03494 0.03028 0.03699 0.03628 0.02723 0.03400 0.04161 0.04009 0.03175 0.03402 0.03402 0.02500 0.02275 0.02274 0.02425 0.02424 0.02951 0.03252 0.06590 0.04240 0.04544 0.03554 0.03098 0.03934 0.04870 0.04714 0.05963 0.04941 0.06742 0.05798 0.04244 0.08447 0.06919 0.06924 0.03622 0.04338 0.04487 0.04160 0.03773 0.04155 0.03399 0.04387 0.04848 0.04619 0.03700 0.03777 0.03777 0.03930 0.03700 0.03699 0.03852 0.03779 0.03778 0.04235 0.06978 0.04774 0.04926 0.04235 0.04081 0.04389 0.05642 0.05484 0.06188 0.05324 0.07453 0.06185 0.04946 0.08592 0.07476 0.07636 0.04572 0.04098 0.03854 0.03922 0.03774 0.03169 0.04080 0.04617 0.04539 0.03700 0.03927 0.03927 0.03623 0.03396 0.03396 0.03548 0.03548 0.04082 0.04541 0.07209 0.04772 0.05159 0.04542 0.04387 0.04616 0.06339 0.06181 0.06497 0.05631 0.07606 0.06571 0.05182 0.08828 0.07623 0.07788 0.04656 0.04032 0.04421 0.04028 0.03402 0.04183 0.04816 0.05049 0.04107 0.04028 0.04028 0.03714 0.03482 0.03483 0.03483 0.03482 0.03953 0.04422 0.07240 0.05049 0.05288 0.04421 0.04107 0.04419 0.05775 0.05616 0.06662 0.05540 0.07480 0.06497 0.05157 0.09154 0.07165 0.07329 0.01762 0.03464 0.03338 0.02660 0.03337 0.04102 0.03796 0.02961 0.03340 0.03340 0.02585 0.02358 0.02434 0.02509 0.02661 0.03114 0.03265 0.06530 0.04026 0.04256 0.03567 0.03263 0.03949 0.05119 0.04962 0.05512 0.04801 0.06842 0.05741 0.04337 0.08123 0.07107 0.07352 0.02698 0.02950 0.02201 0.02798 0.03630 0.03326 0.02499 0.02875 0.02875 0.02127 0.01904 0.01978 0.02053 0.02351 0.03114 0.02951 0.06185 0.03708 0.03937 0.03252 0.02951 0.03632 0.04712 0.04557 0.05332 0.04475 0.06500 0.05483 0.04089 0.07934 0.06757 0.06921 Phylogeny of Fabaceae 3 AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 2 28 1 Table 4. Pairwise genetic distances between members of the Fabaceae and Polygalaceae based on the rbcL gene sequences calculated using Tamura-Nei algorithm 1 Fillaeopsis discophora 2 Adenanthera pavonina 3 Tetrapleura tetraptera 4 Pseudoprosopis fischeri 5 Entada abyssinica 6 Entada camerunensis 7 Entada dolichorrhachis 8 Entada gigas 9 Elephantorrhiza burkei 10 Leucaena leucocephala 11 Kanaloa kahoolawensis 12 Dichrostachys ci nerea 13 Gagnebina pterocarpa 14 Desmanthus illinoensis 15 Neptunia monosperma 16 Neptunia plena 17 Prosopis juliflora 18 Parapiptadenia rigida 19 Microlobius foetidus subsp. foetidus 20 Mimosa acanthocarpa 21 Mimosa pigra 22 Mimosa pudica 23 Mimosa polycarpa var. spegazzinii 24 Acacia cavenia 25 Acacia farnesiana 26 Albizia julibrissin 27 Albizia lophantha 28 Albizia saman 29 Pithecellobium mexicanum 30 Parkia roxburghii 31 Caesalpinia pulcherrima 32 Delonix regia 33 Genista cinerea 34 Gleditsia triacanthos 35 Gymnocladus dioica 36 Parkinsonia aculeata 37 Cassia senna 38 Ceratonia siliqua 39 Brownea ariza 40 Tamarindus indica 41 Bauhinia candicans 42 Cercis siliquastrum 43 Lupinus polyphyllus 44 Anagyris foetida 45 Sophora japonica 46 Lathyrus tuberosus 47 Polygala chamaebuxus 48 Securidaca diversifolia 20 21 22 23 24 25 26 27 28 29 30 31 32 0.02774 0.02086 0.02620 0.03545 0.03232 0.02393 0.02093 0.02093 0.02467 0.02240 0.02392 0.02392 0.02469 0.02471 0.02699 0.05679 0.02624 0.02932 0.02698 0.02546 0.03081 0.04572 0.04337 0.04803 0.03940 0.05836 0.04566 0.03538 0.07691 0.05598 0.05843 0.01605 0.02721 0.03473 0.03245 0.02197 0.02421 0.02421 0.02422 0.02200 0.02348 0.02349 0.02347 0.02800 0.03026 0.06025 0.03703 0.03936 0.03178 0.03025 0.03248 0.04778 0.04779 0.05481 0.04239 0.06259 0.05089 0.04167 0.08435 0.06270 0.06749 0.02049 0.02721 0.02126 0.01606 0.01679 0.01679 0.01532 0.01310 0.01458 0.01458 0.01532 0.02125 0.02274 0.05404 0.02946 0.03098 0.02423 0.02272 0.02571 0.04171 0.03861 0.04473 0.03709 0.05632 0.04549 0.03386 0.07686 0.05889 0.05890 0.02571 0.02721 0.01753 0.02496 0.02496 0.02347 0.02124 0.02124 0.02273 0.02421 0.03101 0.03100 0.06027 0.03630 0.03857 0.03251 0.03098 0.03475 0.04784 0.04628 0.05014 0.04397 0.06180 0.05322 0.04088 0.08505 0.06433 0.06678 0.01756 0.01533 0.03096 0.03096 0.02871 0.02645 0.02646 0.02796 0.03323 0.03554 0.03706 0.06656 0.04087 0.04700 0.03932 0.03703 0.04236 0.05403 0.05247 0.05953 0.05014 0.06812 0.06264 0.04556 0.09254 0.07160 0.07088 0.01387 0.02795 0.02795 0.02723 0.02497 0.02498 0.02647 0.03021 0.03250 0.03553 0.06421 0.03781 0.04390 0.03779 0.03551 0.04084 0.05253 0.05097 0.05322 0.04470 0.06573 0.05948 0.04553 0.08755 0.06926 0.07095 0.01975 0.01975 0.01753 0.01531 0.01532 0.01679 0.02199 0.02425 0.02574 0.05636 0.02950 0.03554 0.02798 0.02573 0.03098 0.04324 0.04170 0.04786 0.03862 0.05947 0.05091 0.03544 0.08016 0.05972 0.06138 0.00000 0.02050 0.01827 0.01975 0.01976 0.02124 0.02352 0.02649 0.05334 0.02727 0.02576 0.02502 0.02350 0.02800 0.04331 0.04177 0.04251 0.03787 0.05409 0.04481 0.03238 0.07371 0.06129 0.06363 0.02050 0.01827 0.01975 0.01976 0.02124 0.02352 0.02649 0.05334 0.02727 0.02576 0.02502 0.02350 0.02800 0.04331 0.04177 0.04251 0.03787 0.05409 0.04481 0.03238 0.07371 0.06129 0.06363 0.00217 0.00362 0.00362 0.01533 0.02201 0.02199 0.05405 0.03022 0.03323 0.02347 0.02198 0.02722 0.04095 0.03786 0.04710 0.03937 0.05712 0.04548 0.03157 0.07610 0.05728 0.06282 0.00145 0.00145 0.01311 0.01978 0.01977 0.05169 0.02797 0.03098 0.02124 0.01976 0.02647 0.03863 0.03710 0.04477 0.03707 0.05476 0.04316 0.02927 0.07361 0.05651 0.06205 0.00289 0.01458 0.02126 0.02125 0.05325 0.02947 0.03248 0.02272 0.02124 0.02796 0.04017 0.03863 0.04632 0.03860 0.05633 0.04470 0.03080 0.07526 0.05809 0.06364 0.01459 0.02127 0.02126 0.05326 0.02948 0.03249 0.02273 0.02125 0.02797 0.04018 0.03864 0.04633 0.03861 0.05634 0.04471 0.03081 0.07526 0.05810 0.06365 0.02426 0.02424 0.05561 0.03248 0.03323 0.02574 0.02274 0.02797 0.04327 0.04172 0.04787 0.03862 0.05949 0.04550 0.03543 0.07781 0.06128 0.06373 0.01164 0.04329 0.01605 0.01901 0.01311 0.00944 0.01090 0.03039 0.02887 0.03411 0.02053 0.04242 0.03179 0.01785 0.06148 0.04332 0.04561 0.04631 0.01827 0.02122 0.00871 0.00725 0.01678 0.03106 0.02954 0.03252 0.02648 0.04703 0.03327 0.01934 0.06631 0.04713 0.05103 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 0.04719 0.04790 0.04869 0.04636 0.04180 0.05577 0.05420 0.05666 0.05042 0.01387 0.03256 0.03634 0.06670 0.06718 0.07584 0.01164 0.01679 0.01385 0.01532 0.03645 0.03491 0.03410 0.02577 0.04631 0.03329 0.02088 0.06633 0.05114 0.05191 0.01753 0.01678 0.01605 0.03791 0.03638 0.03334 0.02873 0.04705 0.03251 0.02237 0.06627 0.05103 0.05411 0.00871 0.01531 0.03486 0.03183 0.03255 0.02648 0.04782 0.03331 0.02164 0.06402 0.04872 0.05265 0.01310 0.03108 0.02956 0.03180 0.02499 0.04550 0.03253 0.01859 0.06635 0.04716 0.05107 0.03263 0.03111 0.03181 0.02206 0.04244 0.02954 0.01860 0.06476 0.04415 0.04797 0.00873 0.04106 0.03571 0.05806 0.04486 0.03243 0.07460 0.05430 0.05663 0.03799 0.03267 0.05648 0.04412 0.03012 0.07133 0.05195 0.05427 0.02279 0.05890 0.04570 0.03246 0.07129 0.05426 0.05969 0.05026 0.04029 0.02782 0.07053 0.04648 0.04963 0.03481 0.03859 0.06749 0.06461 0.07404 0.02320 0.06093 0.05201 0.05752 0.04727 0.08705 0.06296 0.04647 0.08274 0.02347 29 19 Phylogeny of Fabaceae 18 AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 33 Genista cinerea 34 Gleditsia triacanthos 35 Gymnocladus dioica 36 Parkinsonia aculeata 37 Cassia senna 38 Ceratonia siliqua 39 Brownea ariza 40 Tamarindus indica 41 Bauhinia candicans 42 Cercis siliquastrum 43 Lupinus polyphyllus 44 Anagyris foetida 45 Sophora japonica 46 Lathyrus tuberosus 47 Polygala chamaebuxus 48 Securidaca diversifolia 17 Table 4. Pairwise genetic distances between members of the Fabaceae and Polygalaceae based on the rbcL gene sequences calculated using Tamura-Nei algorithm 17 Prosopis juliflora 18 Parapiptadenia rigida 19 Microlobius foetidus subsp. foetidus 20 Mimosa acanthocarpa 21 Mimosa pigra 22 Mimosa pudica 23 Mimosa polycarpa var. spegazzinii 24 Acacia cavenia 25 Acacia farnesiana 26 Albizia julibrissin 27 Albizia lophantha 28 Albizia saman 29 Pithecellobium mexicanum 30 Parkia roxburghii 31 Caesalpinia pulcherrima 32 Delonix regia 33 Genista cinerea 34 Gleditsia triacanthos 35 Gymnocladus dioica 36 Parkinsonia aculeata 37 Cassia senna 38 Ceratonia siliqua 39 Brownea ariza 40 Tamarindus indica 41 Bauhinia candicans 42 Cercis siliquastrum 43 Lupinus polyphyllus 44 Anagyris foetida 45 Sophora japonica 46 Lathyrus tuberosus 47 Polygala chamaebuxus 48 Securidaca diversifolia 30 AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 C G A A - C G 16.43 22.24 15.88 - T 7.98 29.11 10.00 Phylogeny of Fabaceae T - Figure 4. Substitution percentage ratios between nucleotides estimated via maximum likehood group of Lewis and Elias (1981) and suggests that this group is the most primitive group or basal element of the Mimosoideae. This group is morphologically very distinct from other Mimoseae (Nielsen and Guinet, 1992). These findings are contrast from Lewis and Elias (1981) statement, which suggested this group as an advanced group. The base substitution from T ⇒ A at position 1400 is a synapomorpy of the clade with CI equal to 1.0. Elephantorrhiza burkei, which is in the Entada group of Lewis and Elias (1981), is separated to its own independent clade from the four species of Entada used in the analysis. The genus Entada forms a monophyletic group with Entada gigas as the basal taxon. The position of this taxon was not supported by Jackknife analysis. This finding agrees with Lungu (1995) who transferred Entada gigas into a separate subgenus. Entada abyssinica and Entada camerunensis from section Neoentada share 14 apomorphic base substitutions and the clade is well supported by a 97% Jackknife value. A clade containing two representatives of the tribe Acacieae is strongly supported by a Jackknife value of 100%. The Ingeae clade is supported by a 96% Jackknife value. Two species of Acacieae used in this analysis form a clade with Fillaeopsis discophora and Prosopis juliflora. However, this clade is not supported by jackknife analysis. The Kanaloa kahoolawensis and Leucaena leucocephala clade is moderately supported by a 59% Jackknife value. The rbcL sequence data suggest the placement of Kanaloa kahoolawensis in Leucaena group. Using the Mimoseae treatment of Lewis and Elias (1981), Kanaloa keys out to the Leucaena group or Dichrostachys group (Lorence and Wood, 1994). Dichrostachys cinerea shares more apomorphic characters with Gagnebina pterocarpa than with Desmanthus illinoensis. The Dichrostachys group of Lewis and Elias (1981) was not supported by Jackknife analysis. On the Neighbour Joining Phylogram (Figure 6), the Leucaena group is a sister taxon to the Dichrostachys group and they are derived from Parkia roxburghii. This observation is found in only 25% of the 32 most parsimonious trees in this cladistic analysis. The relationships indicated by one of the most parsimonious trees (Figure 7), which occurred in 75% of the most parsimonious trees do not agree with the position of Parkia roxburghii as the basal element of Leucaena and Dichrostachys groups. It needs to be corroborated with other molecular markers to understand the true phylogeny of these groups. The results do not agree with Luckow’s (1993; 1995) morphological cladograms which indicate that the genus Neptunia is a derived member of the Dichrostachys group. The two members from this genus, i. e. Neptunia plena and Neptunia monosperma produce an independent clade, which is supported by 97% Jackknife values. This finding confirms the ambiguous position of Neptunia relative to the other genera of Mimoseae as suggested by Luckow (1997) based on the combined cladistic analysis data from chloroplast DNA restriction sites and morphology. Luckow’s (1993; 1995) cladograms suggested that Neptunia shares a common ancestor with derived species of Desmanthus (e.g. Desmanthus obtusus, Desmanthus cooleyii and Desmanthus reticulatus). The inclusion of only rbcL sequence data of Desmanthus illinoensis, which is a morphologically distantly related from Neptunia in this analysis does not support any close relationship between these two taxa. The rbcL sequence data from other species of Desmanthus is needed to confirm the relative position of these two genera. Jackknife support of 71% is seen for the genus Mimosa clade. Mimosa acanthocarpa from section Batocaulon is the most primitive Mimosa used in the analysis. This finding agrees with Barneby’s (1991), evolutionary hypothesis that species from sections Mimosa and Habbasia are derived from section Batocaulon. The clade of Mimosa pudica and Mimosa pigra is well supported by a 94% Jackknife value. By using morphological characters, Barneby (1991) separated these two species into two different sections. Mimosa pudica and Mimosa polycarpa var spegazzinii are placed in section Mimosa with constantly 4-merous and haplostemonous flowers and leaflets always ciliate, while Mimosa pigra was placed in section Habbasia with diplostemonous flowers and simple trichomes. In this parsimony analysis of rbcL sequences, Mimosa pudica is phylogenetically more related to Mimosa pigra than its morphologically closely related species, Mimosa polycarpa var. spegazzinii. However, the genetic distances based on the Tamura-Nei algorithm between Mimosa pudica and Mimosa polycarpa var. spegazzinii are lower than between Mimosa pudica and Mimosa pigra (Table 4). These findings revealed that based on similarity, Mimosa pudica is closely related to Mimosa polycarpa var. spegazzinii but this species shared more derived characters with Mimosa pigra. More samples of Mimosa are needed to interpret fully these findings. The study shows that nucleotide sequences of the rbcL gene appear to be informative molecular markers. However, the number of nucleotide substitutions of the rbcL gene is too small to provide full support for the infra-tribal relationships and as a result, most nodes within the Mimoseae are not supported by significant Jackknife values. To solve these problems, additional molecular evidence from more variable regions, e.g. trnL-F, ITS and rps16 is needed. AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 b. 50% Majority rule a. Strict 100 59 79 50 97 94 91 96 97 59 83 51 92 51 84 100 Phylogeny of Fabaceae 92 100 100 58 87 Fillaeopsis discophora 100 100 Prosopis juliflora Acacia cavenia 100 Acacia farnesiana Leucaena leucocephala 100 Kanaloa kahoolawensis 75 Dichrostachys cinerea 100 Gagnebina pterocarpa 100 100 Desmanthus illinoensis 100 Neptunia monosperma 75 Neptunia plena 75 Parapiptadenia rigida Microlobius foetidus subsp. foetidus 100 Mimosa acanthocarpa 75 Mimosa pigra Mimosa pudica Mimosa polycarpa var. spegazzinii100 88 Albizia julibrissin 75 Albizia lophantha 100 Albizia saman 100 100 Pithecellobium mexicanum 100 Parkia roxburghii 100 Entada abyssinica 100 Entada camerunensis 100 100 Entada dolichorrhachis Entada gigas Elephantorrhiza burkei Adenanthera pavonina 100 100 Tetrapleura tetraptera Pseudoprosopis fischeri 100 Delonix regia 100 100 Parkinsonia aculeata Cassia senna 100 Caesalpinia pulcherrima Gleditsia triacanthos 100 Gymnocladus dioica Ceratonia siliqua 100 Fillaeopsis Fillaeopsis discophora Prosopis Prosopis juliflora Acacia cavenia Acacieae Acacia farnesiana Leucaena leucocephala Leucaena Kanaloa kahoolawensis Dichrostachys cinerea Gagnebina pterocarpa Dichrostachys Desmanthus illinoensis Neptunia monosperma Neptunia plena Albizia julibrissin Albizia lophantha Ingeae Albizia saman Pithecellobium mexicanum Parkieae Parkia roxburghii Parapiptadenia rigida Microlobius foetidus subsp. foetidus Mimosa acanthocarpa Mimosa pigra Piptadenia Mimosa pudica Mimosa polycarpa var. spegazzinii Entada abyssinica Entada camerunensis Entada dolichorrhachis Entada Entada gigas Elephantorrhiza burkei Adenanthera pavonina Adenanthera Tetrapleura tetraptera Pseudoprosopis fischeri Delonix regia Caesalpinieae Parkinsonia aculeata Cassieae Cassia senna Caesalpinia pulcherrima Gleditsia triacanthos Caesalpinieae Gymnocladus dioica Ceratonia siliqua Cassieae Genista cinerea Lupinus polyphyllus Anagyris foetida Lathyrus tuberosus Sophora japonica Genista cinerea Lupinus polyphyllus Anagyris foetida Lathyrus tuberosus Sophora japonica 100 100 100 100 100 Bauhinia candicans Cercis siliquastrum Brownea ariza Tamarindus indica 100 100 100 Bauhinia candicans Cercis siliquastrum Brownea ariza Tamarindus indica Polygala chamaebuxus Polygala chamaebuxus Securidaca diversifolia Securidaca diversifolia 31 Genisteae Thermopsideae Vicieae Sophoreae Cercideae Detarieae Amherstieae Polygalaceae Key Mimosoideae Caesalpinioideae Papilionoideae Polygalaceae Figure 5. a. Strict consensus tree with jackknife values and b. 50% majority rule tree of 32 most parsimonious trees inferred by the rbcL sequence data. 32 AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Phylogeny of Fabaceae TRIBE 0.012 0.001 0.010 Mimoseae Acacieae Mimoseae Parkieae Mimoseae Mimosoideae Ingeae Mimoseae Caesalpinieae Cassieae Caesalpinieae Genisteae Thermopsideae Vicieae Sophoreae Detarieae Amherstieae Cercideae Polygalaceae Papilionoideae Caesalpinioideae Cassieae Caesalpinioideae Fillaeopsis discocarpa Prosopis juliflora Acacia cavenia 0.009 Acacia farnesiana 0.020 0.004 Leucaena leucocephala 0.013 Kanaloa kahoolawensis 0.002 0.018 Dichrostachys cinerea 0.004 0.018 0.002 Gagnebina pterocarpa 0.003 0.001 0.022 Desmanthus illinoensis 0.008 Parkia roxburghii 0.001 0.011 Neptunia monosperma 0.007 0.007 Neptunia plena 0.002 Albizia julibrizzin 0.000 Albizia lopantha 0.001 0.0050.001 Pithecellobium mexicanum 0.001 Albizia saman 0.012 Parapiptadenia rigida 0.002 0.005 0.004 Microlobius feotida 0.001 0.011 Mimosa acanthocarpa 0.010 0.003 Mimosa pigra 0.004 0.008 0.004 Mimosa pudica 0.002 Mimosa spegazzini 0.019 Adenanthera pavonina 0.001 0.006 0.001 Tetrapleura tetracarpa 0.000 0.001 0.009 Pseudoprosopis fischeri 0.004 Elephantorrhiza burkei 0.007 0.001 Entada abyssinica 0.008 0.027 0.001 Entada camerunensis 0.008 0.002 Entada dolicorachis 0.002 0.006 Entada gigas 0.004 Delonix regia 0.000 0.002 0.005 Parkinsonia aculeata 0.002 0.003 Cassia senna 0.004 Caesalpinia pulcherrima 0.005 Gleditsia triacanthos 0.004 0.007 0.001 Gymnocladus dioica 0.001 0.006 Ceratonia siliqua 0.006 Genista cinerea 0.015 0.008 0.003 Lupinus polyphyllus 0.012 0.004 0.001 Anagyris foetida 0.044 0.005 Lathyrus tuberosus 0.005 Sophora japonica 0.005 Brownea ariza 0.014 0.003 Tamarindus indica 0.015 Bauhinia candicans 0.006 0.024 0.007 Cercis siliquastrum 0.010 Polygala chamaebuxus 0.013 Securidaca diversifolia 0.002 FAMILY Figure 6. Phylogenetic tree constructed from the nucleotide sequences of the rbcL gene using the neighbour-joining method with relative genetic distance values indicated. AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Phylogeny of Fabaceae TRIBE FAMILY 16 Fillaeopsis discocarpa Mimoseae Prosopis juliflora Acacia cavenia 12 Acacieae Acacia farnesiana 23 Leucaena leucocephala 6 21 Kanaloa kahoolawensis 6 24 Dichrostachys cinerea 12 25 9 Gagnebina pterocarpa Mimoseae 7 24 Desmanthus illinoensis 14 Neptunia monosperma 13 10 Neptunia plena 3 2 3 Albizia julibrizzin Albizia lopantha 6 Ingeae 2 Albizia saman 2 3 Pithecellobium mexicanum 10 Parkia roxburghii Parkieae 1 16 Parapiptadenia rigida 2 6 Microlobius feotida 1 14 Mimosa acanthocarpa 13 7 Mimosa pigra 5 11 7 Mimosa pudica 1 3 Mimosa spegazzini 11 Entada abyssinica 14 35 6 Entada camerunensis Mimoseae 9 2 Entada dolicorachis 6 8 Entada gigas 4 Elephantorrhiza burkei 26 Adenanthera pavonina 1 2 12 2 Pseudoprosopis fischeri 8 Tetrapleura tetracarpa 5 Delonix regia 5 2 Caesalpinieae 7 5 Parkinsonia aculeata 3 Cassieae Cassia senna 4 Caesalpinieae Caesalpinia pulcherrima 6 Cassieae Ceratonia siliqua 7 Gleditsia triacanthos Caesalpinieae 7 9 Gymnocladus dioica 8 Genista cinerea 19 Genisteae 11 11 Lupinus polyphyllus 17 13 Anagyris foetida Thermopsideae 52 Lathyrus tuberosus Vicieae 4 Sophora japonica Sophoreae 20 Bauhinia candicans Cercideae 11 Cercis siliquastrum 7 Detarieae Brownea ariza 5 Amherstieae Tamarindus indica 14 Polygala chamaebuxus Polygalaceae 18 Securidaca diversifolia 5 5 4 9 35 18 Figure 7. One of the most parsimonious trees phylogram with branch lengths indicated. Caesalpinioideae 8 Papilionoideae 5 Caesalpinioideae 5 Mimosoideae 1 14 33 34 AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Phylogeny of Fabaceae Barneby, R. C. 1991. Sensitivae Censitae. A description of the Genus Mimosa L. (Mimosaceae) in the New World. Memoirs of the New York Botanical Garden 65: 1-835. Lewis, L. A., Mishler, B. D. and Vilgalys, R. 1997. Phylogenetic relationships of the Liverworts (Hepaticae), a basal embryophyte lineage, inferred from nucleotide sequence data of the chloroplast gene rbcL. Molecular Phylogenetics and Evolution 7: 377-393. Bentham, G. 1875. Revision of the suborder Mimoseae. Transactions of the Linnean Society of London 30: 335-664. Lorence, D. H. and Wood, K. R. 1994. Kanaloa, a New Genus of Fabaceae (Mimosoideae) from Hawaii. Novon 4: 137-145. Chase, M. W., Soltis, D. E., Olmstead, R. G., Morgan, D., Les, D. H., Mishler, B. D., Duvall, M. R., Price, R., Hills, H. G., Qiu, Y.-L., Kron, K. A., Rettig, J. H., Conti, E., Palmer, J. D., Manhart, J. R., Sytsma, K. J., Michaels, H. J., Kress, M. J., Karol, K. G., Clark, W. D., Hedren, M., Gaut, B. S., Jansen, R. K., Kim, K. J., Wimpee, C. F., Smith, J. F., Furnier, G. R., Strauss, S. H., Xiang, Q. -Y, Plunkett, G. M., Soltis, P. S., Swensen, S. M., Williams, S. E., Gadek, P. A., Quinn, C. J., Equiarte, L. E., Golenberg, E., Learn, G. H. Jr., Graham, S. W., Barrett, S. C. H., Dayanandan, S. and Albert, V. A. 1993. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL. Annals of the Missouri Botanical Garden 80: 528-580. Luckow, M. 1993. A monograph of the genus Desmanthus (Fabaceae: Mimosoideae). Systematic Botany Monograph 38: 1-166. REFERENCES Chappill, J. A. 1995. Cladistic analysis of the Fabaceae: The development of an explicit phylogenetic hypothesis. In: M. Crisp & J. J. Doyle (editors). Advances in Legume Systematics 7: Phylogeny, pp. 1-9. Royal Botanic Gardens, Kew. Doyle, J. J. 1995. DNA Data and the Legume Phylogeny: A Progress Report. In: M. D. Crisp and J. J. Doyle (editors). Advances in Legume Systematics 7: Phylogeny, pp. 11-30. Royal Botanic Gardens, Kew. Doyle, J. J. and Doyle, J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19: 1115 Doyle, J. J., Doyle, J. L., Ballenger, J. A., Dickson, E. E., Kajita, T. and Ohashi, H. 1997. A phylogeny of the Chloroplast gene rbcL in the Fabaceae: Taxonomic correlations and insights into the evolution of nodulation. American Journal of Botany 84: 541554. Elias, T. S. 1981. Mimosoideae. In: R.M. Polhill and P.H. Raven (editors.). Advances in Legume Systematics. Part 1, pp.143-151. Royal Botanic Gardens, Kew. Farris, J. S., Albert, V. A., Kallersjo, M., Lipscomb, D. and Kluge, A. G. 1996. Parsimony Jackknifing outperforms neighbour-joining. Cladistics 12: 99-124. Kass, E. and Wink, M. 1995. Molecular Phylogeny of the Papilionoideae (Family Fabaceae): rbcL Gene Sequences versus Chemical Taxonomy. Botanical Acta 108: 149-162. Kass, E. and Wink, M. 1996. Molecular Evolution of the Fabaceae: Phylogeny of the three Subfamilies Based on rbcL-sequences. Biochemical Systematics and Ecology 24: 365-378. Lewis, G. P. and Elias, T. 1981. Mimoseae. In: R. M. Polhill and P.H. Raven (editors). Advances in the Legume Systematics, Part 1, pp. 155-168. Royal Botanical Gardens, Kew. Luckow, M. 1995. A phylogenetic analysis of the Dichrostachys group (Mimosoideae: Mimoseae). In: M. Crisp and J. J. Doyle (editors). Advances in Legume Systematics 7: Phylogeny, pp. 63-76. Royal Botanic Gardens, Kew. Luckow, M. 1997. Generic relationships in the Dichrostachys group (Fabaceae: Mimosoideae): Evidence from chloroplast DNA restriction sites and morphology. Systematic Botany 22: 189-198 Lungu, S. 1995. Systematic and Economic Botany of the Genus Entada Adans. PhD. Thesis. University of Reading. Nielsen, I. C. and Guinet P. 1992. Synopsis of Adenanthera (FabaceaeMimosoideae). Nordic Journal of Botany 12: 85-114. Olmstead, R. G. and Palmer, J. D. 1994. Chloroplast DNA systematics: A review of methods and data analysis. American Journal of Botany 81: 1205-1255. Polhill, R. M., Raven, P. H., and Stirton, C. H. 1981. Evolution and systematics of the Fabaceae. In: R. M. Polhill and P. H. Raven (editors). Advances in Legume Systematics, Part 1, pp. 1-26. Royal Botanic Gardens, Kew. Polhill, R. M. 1994. Classification of the Fabaceae. In: F. A. Bisby, J. Buckingham and J. B. Harborne (editors). Phytochemical Dictionary of the Fabaceae, Vol. 1, pp. xxxv-xlviii. Chapman and Hall, London. Sulaiman, S. F. 1997. Chemotaxonomic studies of the tribe Mimoseae. PhD Thesis. University of Reading, United Kingdom. Tamura, K. and Nei, M. 1993. Estimation of the number of nucleotide substitutions in the control region mitocondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10: 512-526. Tucker, S. C. and Douglas, A. W. 1994. Ontogenetic evidence and phylogenetic relationships among basal taxa of Legumes. In: I. K. Ferguson and S. Tucker (editors). Advances in Legume Systematics 6: Structural Botany, pp. 11-32. Royal Botanic Gardens, Kew. Zurawski, G., Perrot, B., Bottomley, W. and Whitfield, P. R. 1981. The structure of the gene for the large subunit of ribulose 1,5-bisposphate carboxylase from spinach chloroplast DNA. Nucleic Acids Research 9: 3251-3269. AsPac J. Mol. Biol. Biotechnol., Vol. 11 (1), 2003 Zurawski, G., Bottomley, W. and Whitfield, P. R. 1986. Sequence of the genes for the and, subunits of ATP synthase from pea chloroplast. Nucleic Acids Research 14: 3974. Phylogeny of Fabaceae 35