Phylogenetic studies in the Hoya group (Apocynaceae,
Marsdenieae): the position of Anatropanthus and
Oreosparte
Authors: Rodda, Michele, Simonsson, Nadhanielle, Ercole, Enrico,
Khew, Gillian, Niissalo, Matti, et al.
Source: Willdenowia, 50(1) : 119-138
Published By: Botanic Garden and Botanical Museum Berlin (BGBM)
URL: https://doi.org/10.3372/wi.50.50112
BioOne Complete (complete.BioOne.org) is a full-text database of 200 subscribed and open-access titles
in the biological, ecological, and environmental sciences published by nonprofit societies, associations,
museums, institutions, and presses.
Your use of this PDF, the BioOne Complete website, and all posted and associated content indicates your
acceptance of BioOne’s Terms of Use, available at www.bioone.org/terms-of-use.
Usage of BioOne Complete content is strictly limited to personal, educational, and non - commercial use.
Commercial inquiries or rights and permissions requests should be directed to the individual publisher as
copyright holder.
BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit
publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to
critical research.
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Willdenowia
Annals of the Botanic Garden and Botanical Museum Berlin
MICHELE RODDA1*, NADHANIELLE SIMONSSON2, ENRICO ERCOLE3, GILLIAN KHEW1, MATTI
NIISSALO1, SRI RAHAYU4 & TATYANA LIVSHULTZ5
Phylogenetic studies in the Hoya group (Apocynaceae, Marsdenieae): the position of
Anatropanthus and Oreosparte
Version of record first published online on 27 March 2020 ahead of inclusion in April 2020 issue.
Abstract: Recent molecular phylogenetic studies have shown that Hoya is paraphyletic without Absolmsia, Clemensiella, Madangia, and Micholitzia. These genera have been placed in synonymy with Hoya, but the monophyly
of Hoya sensu lato relative to other genera of the broader Hoya group (Dischidia, Anatropanthus and Oreosparte,
the latter two never included in a molecular phylogenetic analysis) remained unclear. Furthermore, no analysis has
included both a significant sample of the Hoya group and outgroup genera of Marsdenieae to test the monophyly
of the Hoya group and its position within the tribe. To address these gaps, we assembled two data sets: (1) the chloroplast trnT-trnL-trnF locus from 110 species and (2) three chloroplast loci (trnT-trnL-trnF, atpB-psbA spacer and
matK) and two nuclear loci (nrDNA ITS and ETS) from 54 species. The Hoya group is monophyletic and nested in
an Asian/Australian clade of Marsdenia s.l. The genus Hoya is paraphyletic unless Anatropanthus, Dischidia and
Oreosparte are included. However, current evidence is not sufficient to synonymize Dischidia and Oreosparte with
Hoya. Support for synonymy of Anatropanthus with Hoya is strong and the new name H. insularis is proposed. A
clade of three new species with Oreosparte-like morphology is sister to the rest of the Hoya group and is described
as the new genus Papuahoya.
Key words: Anatropanthus, Apocynaceae, Dischidia, epiphyte, Hoya, Marsdenia, Marsdenieae, molecular phylogeny, new genus, new species, Oreosparte, Papuahoya, systematics
Article history: Received 29 July 2019; peer-review completed 29 October 2019; received in revised form 12 February 2020; accepted for publication 18 February 2020.
Citation: Rodda M., Simonsson N., Ercole E., Khew G., Niissalo M., Rahayu S. & Livshultz T. 2020: Phylogenetic
studies in the Hoya group (Apocynaceae, Marsdenieae): the position of Anatropanthus and Oreosparte. – Willdenowia 50: 119 – 138. doi: https://doi.org/10.3372/wi.50.50112
Introduction
Hoya R. Br. (Fig. 1A, B) (Marsdenieae, Asclepiadoideae) is the largest genus in Apocynaceae, comprising
350 – 450 species of Asian and Australasian succulent
epiphytic and terrestrial vines and shrubs (Rodda 2015)
that are highly prized horticulturally for their showy
“wax” flowers. The flowers of Hoya are characterized
by the presence of a staminal corona with the proximal (apical) part of the lobe entire, distal (basal) part
of the lobe with an “anther skirt” and revolute margins
containing nectaries. The anther guide rails lack inner
edges and the pollinia have a pellucid margin along the
outer edge (Wanntorp & Kunze 2009; Endress & al.
2019).
The Hoya group — Hoya has been associated with a
number of smaller genera including Absolmsia Kuntze
(1 sp.), Anatropanthus Schltr. (1 sp.) (Fig. 2), Clemensiella Schltr. (2 spp.), Dischidia R. Br. (c. 80 spp.) (Fig.
1 Singapore Botanic Gardens, National Parks Board, 1 Cluny Road, Singapore 259569, Singapore; *e-mail: rodda.michele@
gmail.com (author for correspondence).
2 Research affiliate at National Research Institute of Papua New Guinea. Home address: Hjälmarvägen 5, 70283 Örebro, Sweden.
3 Dipartimento di Scienze della Vita e Biologia dei Sistemi, Viale PA Mattioli 25, 10125 Torino, Italy.
4 Bogor Botanic Gardens, Indonesian Institute of Sciences, Bogor, Indonesia.
5 Drexel University and the Academy of Natural Sciences, 1900 Benjamin Franklin Parkway, Philadelphia, PA 19103, U.S.A.
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
120
1C, D), Heynella Backer (1 sp.), Madangia P. I. Forst. &
al. (1 sp.), Micholitzia N. E. Br. (1 sp.) and Oreosparte
Schltr. (1 sp.) (Fig. 1E, F) in what has come to be termed
the “Hoya group” (Omlor 1996, 1998; Wanntorp & Forster, 2007; Meve & al. 2009). A combination of characters
separate these genera from the rest of Marsdenieae including succulent and epiphytic growth form (vs. woody
and terrestrial), highly condensed, persistent inflorescences that re-flower multiple times before they senesce
(vs. expanded, once-flowering deciduous inflorescences),
valvate corolla lobes in bud (vs. contorted), and narrow,
spindle-shaped seeds (vs. flattened, ovate seeds) (Omlor
1998). However, many of these diagnostic characters are
variable within the Hoya group (e.g. H. coronaria Blume
is a terrestrial vine; H. lanceolata Wall. ex D. Don has
ephemeral inflorescences).
The Hoya group has always received strong support
as monophyletic in molecular phylogenetic analyses that
have sampled at least two of the included genera along
with other Marsdenieae genera (Potgieter & Albert 2001;
Verhoeven & al. 2003; Meve & Liede 2004; Wanntorp &
al. 2006a, 2006b, 2011; Surveswaran & al. 2014). However, the studies with the best sampling of Hoya group
taxa have had the sparsest sampling of other Marsdenieae
genera (Wanntorp & al. 2011) and vice versa (Verhoeven
& al. 2003; Meve & Liede 2004).
In the most comprehensive analysis of the Hoya
group to date (Wanntorp & al. 2014), Hoya was not supported as monophyletic relative to Absolmsia, Clemensiella, Dischidia, Mandangia or Micholitzia. The larger
infrageneric sampling of Hoya sensu stricto in Wanntorp
& al. (2014: fig. 3, 4) does not allow evaluation of the
monophyly of Hoya relative to Dischidia because the latter was designated as the outgroup. In a taxonomically
reduced dataset (their fig. 5A), Dischidia is nested within
Hoya but with minimal bootstrap support. All of these
genera except Dischidia have been synonymized with
Hoya (Wanntorp & Forster 2007; Wanntorp & Meve
2011). Floral characters including pollinia with pellucid
margins, anther guide rails without inner edges, and presence of nectaries inside the revolute margins of the outer
processes of the staminal corona lobes, i.e. the “anther
skirt”, support the inclusion of Absolmsia, Mandangia
and Micholitzia in Hoya s.l. (Wanntorp & Forster 2007;
Wanntorp & Kunze 2009). Clemensiella lacks these traits
but shares similarities of terrestrial growth form and pollinium morphology with species of the atypical H. sect.
Eriostemma Schltr. (Wanntorp & Meve 2011). With the
inclusion of Clemensiella, Hoya s.l. becomes very heterogeneous, with a circumscription that includes most
of the morphological variation within the larger Hoya
group. This extension of Hoya mirrors a trend toward expansion of generic boundaries consequent to molecular
phylogenetic analyses of other large Apocynaceae genera
including Ceropegia L. (Bruyns & al. 2015), Cynanchum
L. (Khanum & al. 2016) and Vincetoxicum Wolf (LiedeSchumann & al. 2012).
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Rodda & al.: Phylogenetic studies in the Hoya group
Anatropanthus Schltr. and Oreosparte Schltr. — Anatropanthus, Heynella and Oreosparte are the most poorly
known genera of the Hoya group (Omlor 1998). No authentic material of these three genera was available for
study until O. celebica Schltr. was neotypified (Rodda
& Omlor 2013) and a detailed description and illustrations were provided. Oreosparte shares all the diagnostic
characters of the Hoya group, but its corona and pollinaria are distinct from both those of Dischidia and Hoya.
Oreosparte celebica has erect staminal corona lobes
with bifid apices and without revolute margins; the pollinarium has very narrow caudicles and pollinia without
pellucid margins. In contrast, Hoya has corona lobes
with entire apices and generally revolute margins, while
Dischidia typically has inverted anchor-shaped staminal
corona lobes. The pollinaria of both Dischidia and Hoya
generally have well-developed, broad caudicles and the
pollinia of Hoya typically have pellucid margins. Other
undescribed species with the “Oreosparte floral phenotype”, i.e. presence of urceolate corollas and stipitate gynostegium with erect corona lobes, have been discovered
in herbaria or collected in the field and are also sampled.
Anatropanthus borneensis Schltr. was known only from
its type specimen collected in 1901 in Sarawak, Malaysia, and destroyed during the fire of the Berlin Herbarium
in 1943 (Hiepko 1978; Nicholas 1992). It was recently
collected in Kalimantan, Indonesia. Its flowers have a peculiar, curved pedicel that is similar to that of H. retrorsa
Gavrus & al. The corolla is unique in the Hoya group:
tubular, apically inflexed and terminating in erect, lanceolate lobes (Fig. 2). The gynostegium has oblong, concave corona lobes, erect and attached at the back of the
anthers. The pollinia are erect, with a pellucid margin all
along the outer margin as generally seen in Hoya. Given
the morphological heterogeneity of Hoya, a molecular
phylogenetic analysis is necessary to ascertain whether
Anatropanthus and Oreosparte should be maintained as
separate genera from Hoya.
Hoya sections — In addition to the difficulty of drawing
the generic boundaries of Hoya, no complete infrageneric
system has been published to date. Infrageneric groups in
Hoya are circumscribed based on the shape of the corolla
(campanulate, urceolate, rotate, revolute), the corona
(size and shape of the staminal corona lobes and their inner and outer processes) and the pollinaria (size and shape
of corpusculum, pollinia and caudicles, presence of pellucid margin of the pollinia). The first infrageneric classification of Hoya s.l. was published by Miquel (1856),
who recognized six sections: H. sect. Cathetostemma
(Blume) Miq., H. sect. Hoya (published as “Euhoya”),
H. sect. Otostemma (Blume) Miq., H. sect. Physostemma
(Blume) Miq., H. sect. Plocostemma (Blume) Miq. and
H. sect. Sperlingia (Vahl) Miq. Subsequently, Hooker
(1885) added three more sections: H. sect. Ancistrostemma Hook. f., H. sect. Cyrtoceras (Bennett) Hook. f. and
H. sect. Pterostelma (Wight) Hook.f.; and Schlechter
Willdenowia 50 – 2020
121
Fig. 1. Morphological diversity within the Hoya group. – A: Hoya lasiantha, epiphytic shrub growth form; B: H. lasiantha, flowers
with reflexed corollas and prominent coronas; C: Dischidia major, ant-house leaves; D: D. major, flowers with closed, urceolate
corollas; E: Oreosparte celebica, cultivated plant; F: O. celebica, flower with urceolate corolla. – Photographs: A – D by M. Rodda;
E, F by D. White.
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
122
Rodda & al.: Phylogenetic studies in the Hoya group
Fig. 2. Anatropanthus borneensis. – A: inflorescence; B: flower, side view; C: corona, side view. – Drawn by Loh Xiang Yun, based
on Somadee s.n. (SING).
(1913, 1915) added another four sections: H. sect. Eriostemma, H. sect. Oreostemma Schltr., H. sect. Peltostemma Schltr. and H. sect. Physostelma (Wight) Schltr. The
sectional classification of Hoya was further developed by
Burton (1985, 1995, 1996a, 1996b, 1996c) and Kloppenburg (1993, 1994), who used up to 21 sections. A critical revision of the infrageneric classification of Hoya has
never been published. While sections such as H. sect.
Eriostemma are supported as monophyletic in molecular analyses, others such as H. sect. Cyrtoceras and H.
sect. Plocostemma are not (Wanntorp & al. 2011). In the
most recent phylogeny, Wanntorp & al. (2014) divided
Hoya s.l. into six unnamed clades, some of which are diagnosable by morphology (e.g. growth form, pollinium
and corona structure, nectar colour) and/or biogeogra-
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
phy, but only two of these can be readily aligned with
previously published sections: H. sect. Acanthostemma
(Blume) Kloppenburg and H. sect. Eriostemma.
Dischidia R. Br. — Like Hoya s.l., the circumscription of
Dischidia has been expanded to include eight segregate
genera: Collyris Vahl, Conchophyllum Blume, Dischidiopsis Schltr., Dolichostegia Schltr. (monotypic), Hoyella
Ridl. (monotypic), Leptostemma Blume, Oistonema
Schltr. (monotypic) and Spathidolepis Schltr. (monotypic) (Omlor 1998; Forster 2000; Livshultz 2003a,
2003b). Combinations in Dischidia exist for species of all
of these genera. Typical of the taxonomic history of other
genera within Asclepiadoideae, most of these segregates
were diagnosed by the divergent structure of the stami-
Willdenowia 50 – 2020
nal corona relative to the membranous, inverted-anchorshaped lobes characteristic of Dischidia s.s. However,
later taxonomists, again consistent with trends across the
subfamily, recognized a diversity of corona morphologies
within Dischidia s.l. (Rintz 1980; Livshultz & al. 2005).
In a molecular phylogenetic analysis of 46 ingroup species and eight outgroup Marsdenieae species (including
Hoya, Marsdenia R. Br. and Telosma Coville) based on
the second intron of the nuclear gene Leafy, there was
strong support for monophyly of Dischidia s.l. including
Collyris, Conchophyllum, Dischidiopsis, Leptostemma
and Oistonema (Livshultz 2003b).
The most frequently used infrageneric classification
of Dischidia divides it into three sections based on leaf
morphology: D. sect. Dischidia with unmodified, laminar
leaves; D. sect. Conchophyllum (Blume) K. Schum. with
concavo-convex, shell-shaped, ant-house leaves; and D.
sect. Ascidiophora K. Schum. with dimorphic leaves,
producing both unmodified, laminar leaves and pouchshaped, ant-house leaves (Livshultz 2003b). Molecular
phylogenetic evidence indicated that D. sect. Dischidia
is paraphyletic to a clade that includes all sampled species of D. sect. Ascidiophora and D. sect. Conchophyllum, while relationships between the latter two taxa were
unresolved (Livshultz 2003b).
In this study, we test (1) the monophyly and phylogenetic position of the Hoya group in an analysis that
includes both a representative sample of Hoya group
taxa and other Marsdenieae genera, and (2) the current
circumscription of Hoya, specifically asking if there is
sufficient evidence for expanding the synonymy of Hoya
to include Anatropanthus, Dischidia and Oreosparte. We
sample A. borneensis, O. celebica Schltr. and other putative Oreosparte species for the first time. We include
a substantially expanded sample of Dischidia, including
its type species D. nummularia R. Br., and of Marsdenia species relative to previous analyses (Wanntorp & al.
2011; Wanntorp & al. 2014).
Material and methods
Sampling Matrix 1 (110 taxa) — To test the position of
the Hoya group and Oreosparte within Marsdenieae, we
modified the trnT-L spacer, trnL intron, trnL-F spacer dataset of Meve & Liede (2004), which includes the largest
generic sample of Marsdenieae published to date (9 of 27
currently recognized genera; Endress & al. 2019; Espírito
Santo & al. 2019). We excluded the species of Periplocoideae, which are only distantly related to Asclepiadoideae
(Straub & al. 2014), the single unidentified Marsdenia
species, and the Hoya group species, and then added 54
species of Marsdenieae, primarily of the Hoya group,
and a sample of Vincetoxicum flexuosum (R. Br.) Kuntze
(Asclepiadeae). We included 12 Dischidia species, representing the morphological diversity of the genus including morphologies diagnostic of the synonymized genera
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
123
Conchophyllum, Dischidiopsis and Leptostemma, Anatropanthus borneensis, Oreosparte celebica and three
other putative, undescribed Oreosparte species. We sampled 33 Hoya species including all synonymized genera
and representatives of all major clades identified in the
latest phylogeny of the genus (Wanntorp & al. 2014), including H. urniflora (P. I. Forst.) Simonsson & Rodda
(Marsdenia urniflora P. I. Forst.) (Simonsson Juhonewe
& Rodda 2017). We included all Hoya group species
sampled by Wanntorp & al. (2014) where the complete
six-locus dataset was available and where the identity of
the species could be verified by examining the voucher
specimen. Early-diverging lineages of Hoya were more
densely sampled than highly nested ones. For other
Marsdenieae, we added one species of Jasminanthes,
namely J. maingayi (Hook. f.) Rodda [Marsdenia maingayi (Hook. f.) P. I. Forst.] and four additional species
of Marsdenia, including M. ridleyi P. I. Forst, a species
that displays “Oreosparte floral phenotype”, to increase
sampling of this morphologically heterogeneous genus.
Sampling Matrix 2 (54 taxa) — In a second analysis, we
reduced outgroup sampling and increased sequence sampling to investigate inter- and intrageneric relationships
with the Hoya group. We limited the taxon sample to the
54 Marsdenieae species used in Matrix 1 and used Jasminanthes maingayi, Marsdenia flavescens A. Cunn. and
M. rostrata R. Br. to root the tree. We added the chloroplast trnH-psbA spacer and part of the matK gene as well
as the nuclear 5′-ETS and ITS loci to all samples.
The new specimens for the present study were obtained during fieldwork in Papua New Guinea, from the
extensive living research collections at Singapore Botanic Gardens (Singapore) and Nong Nooch Tropical
Botanical Garden (Thailand) and from herbarium specimens at E and SNP (herbarium codes according to Index herbariorum; http://sweetgum.nybg.org/science/ih/).
Identification of specimens was carried out by consulting the relevant taxonomic literature including all protologues and comparing our collections with reference herbarium materials at the herbaria A, BISH, BK, BKF, BM,
BRUN, FI, G, HBG, IBSC, K, KEP, KUN, L, M, MO,
P, SAN, SAR, SING, SNP, TO, UC, US, W and WRSL.
Vouchers are listed in Appendix 1 (in Supplemental Content online).
DNA extraction, PCR amplification and sequencing —
Silica-dried or fresh leaf samples were extracted using
DNeasy® Plant Mini Kit (Qiagen Inc., Valencia, California, U.S.A.). PCR amplification and sequencing were carried out using the primer pairs ITS5 and ITS4 for the ITS
spacer (White & al. 1990), AsETS-F and AsETS-R for 5′ETS (Yamashiro & al. 2004), psbA3′f/trnHf (Sang & al.
1997; Tate & Simpson 2003) for psbA-trnH, trnTUGU(a)
and trnLUAA(b) for trnT-trnL and trnL(c)-trnF(f) for the
trnL intron amplified together with the trnF gene (Taberlet & al. 1991), and 390F and 1326R for the matK gene
124
Rodda & al.: Phylogenetic studies in the Hoya group
(Cuénoud & al. 2002). Internal primers were designed for
the trnT-trnL locus of Oreosparte based on Oreosparte
sp. 1 trnT-LfOre TCACAAATCAATACAATTTACAA
and trnT-LrOre TGAATGGAATGAAAGCGGAGG.
PCR amplification was carried out using Phusion Green
High-Fidelity DNA Polymerase (Thermo Scientific) in
25 μl reactions, containing a concentration of 0.4 μM of
each primer and approximately 50 ng of total DNA. PCR
followed a three-step cycle with initial denaturation at
98°C for 30 seconds, 35 cycles of denaturation at 98°C
for 10 seconds, primer annealing at 50°C (matK, ITS,
psbA-trnH), 52°C (trnT-L, trnL-F) or 50°C (ETS) for 15
seconds, and primer extension at 72°C for 30 seconds,
with a final extension at 72°C for 10 minutes.
The PCR products were purified using Wizard® PCR
and gel clean-up system (Promega Corporation, Madison, Wisconsin, U.S.A.), according to the manufacturer’s
recommendations. AITBiotech Pte Ltd, Singapore, performed sequencing. Forward and reverse reads were assembled with Geneious Version 8.0 (Biomatters LLC) and
the new sequences deposited in GenBank (Appendix 1 in
Supplemental Content online).
(Swofford 2002). To find most parsimonious trees, a heuristic search with TBR branch swapping of 1000 random
starting trees was conducted, saving up to 10 equally
parsimonious trees per iteration, followed by swapping
to completion on all equally parsimonious trees, or until
10 000 trees were saved. The resulting trees were used to
construct a strict consensus. The bootstrap analysis consisted of 1000 resampled replicates, with TBR swapping
on one random starting tree, saving a maximum of 20
equally parsimonious trees per replicate and calculating
the strict consensus tree from each replicate.
Alignment and matrix construction — Sequences of
each locus were aligned with the ClustalW (Larkin & al.
2007) plugin in Geneious prime 2019.0.4 (https://www
.geneious.com/) using default parameters and adjusted by
eye to correct obvious mis-alignments. Regions of ambiguous alignment were removed with GBLOCKS (Talavera & Castresana 2007) run on the GBLOCKS server
version 0.91b (http://molevol.cmima.csic.es/castresana
/Gblocks_server.html). For the trnT-trnL and trnL-F matrices, GBLOCKS was accessed on 5 May 2019 and sites
selected using the following criteria: minimum number of
sequences for a conserved position: 56; minimum number
of sequences for a flanking position: 56; maximum number
of contiguous non-conserved positions: 8; minimum
length of a block: 5; allowed gap positions: with half. For
ITS, ETS, psbA-trnH and matK, GBLOCKS was accessed
on 5 May 2019 using the following selection criteria: minimum number of sequences for a conserved position: 28;
minimum number of sequences for a flanking position: 28;
maximum number of contiguous non-conserved positions:
8; minimum length of a block: 5; allowed gap positions:
with half. Indels were not coded as characters because they
are not modelled by the GTR family of models.
Results
Incongruence — Each of the six loci was analysed independently, then concatenated into a nuclear matrix and a
chloroplast matrix, and finally into a combined nuclear
plus chloroplast matrix. Incongruence between the nuclear and chloroplast matrices and parsimony and ML
analyses was assessed by identifying contradictory clades
with moderate to high bootstrap support (BS > 75).
Parsimony tree searches, consensus tree calculation and
bootstrap — Analyses were conducted with PAUP 4.0a
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Maximum likelihood tree searches and bootstrap —
Analyses were conducted with RAxML 8.2.11 (Stamatakis 2014) as implemented on Geneious prime 2019.0.4
(https://www.geneious.com/). The GTR plus GAMMA
model of nucleotide substitution was applied in all steps
of the analysis. The search for maximum likelihood trees
combined the tree search and the rapid bootstrap analysis
(-f a) using 10 000 rapid bootstrap iterations followed by
a tree search through ML. Datasets were not partitioned.
Sequencing — In total 227 new sequences were generated for this study (Appendix 1 in Supplemental Content
online), including 15 from species previously sampled
by Wanntorp & al. (2014), two from Hoya corymbosa
Rodda & Simonsson, previously sampled in Rodda & al.
(2013), two from H. papaschonii Rodda, previously sampled in Rodda & Ercole (2014), and 209 from 34 newly
sampled species.
Matrices — Summary statistics are shown in Table 1. Taxon sampling was complete for each locus. As judged from
the number of aligned positions removed by GBLOCKS,
the alignment of the psbA-trnH locus had by far the most
gaps and alignment ambiguity (only 314 of 820 aligned
positions retained for analysis, Table 1). For Matrix 2 (54
taxa), the ITS locus contributed the largest number of
PICs (160) and the trnL-F locus the fewest (37) (Table 1).
Incongruence — There were no moderately to strongly
supported (BS > 75) incongruences between parsimony
and ML analyses of any data matrix (data not shown).
The only moderately to strongly supported incongruence
between chloroplast and nuclear loci concerns the position of Dischidia milnei Hemsl., which was supported as
sister to D. major (Vahl) Merr. by the cp loci (ML BS 90 )
versus sister to the rest of the ant-house-leaved Dischidia
species by the nuclear loci (ML BS 97). In the combined
analysis, D. milnei is placed in the position favoured by
the nuclear loci but with poor support (ML BS 57) (Fig.
4). Support for the sister-group relationship of D. milnei
and D. major appears to come primarily from the trnTtrnL locus, which has two unambiguous synapomorphies
Willdenowia 50 – 2020
125
Table 1. Summary statistics of matrices and analyses.
Matrix
number
Matrix
Alignment length
(base pairs)
Alignment length
(after GBLOCKS)
Number of PICs
(after GBLOCKS)
1
110 – cp
N/A
1634
296
2
110 – trnT-trnL
1338
774
162
3
110 – trnL-trnF
1093
860
134
4
54 – combined nu + cp
N/A
3900
512
5
54 – cp
N/A
2869
241
6
54 – trnT-trnL
1338
774
58
7
54 – trnL-trnF
1093
860
37
8
54 – psbA-trnH
820
314
76
9
54 – matK
921
921
70
10
54 – nu
N/A
1031
271
11
54 – ETS
388
369
111
12
54 – ITS
700
662
160
that favour this relationship. There are no unambiguous
synapomorphies for this relationship in parsimony analyses of any of the other three chloroplast loci (data not
shown).
Topology — ML topologies are shown in Fig. 3 and 4
with BS support (ML/parsimony) indicated at each node.
Nodes absent from the parsimony strict consensus tree
are indicated with “−”. Only the ML BS support will be
mentioned in the descriptions below.
Analysis 1: 110-taxon matrix (Fig. 3) — The monophyly
of each tribe of Asclepiadoideae is strongly supported
(BS 90–100), as are the position of tribe Fockeeae as
sister to the rest of the subfamily (BS 100) and the sister-group relationship of Ceropegieae and Marsdenieae
(BS 93). The position of Eustegieae as sister to Ceropegieae plus Marsdenieae is moderately supported (BS
75). Within Marsdenieae, there is a polytomy among
three well-supported clades: (1) an African and Madagascan clade of two taxa, Marsdenia verrucosa Decne.
and Rhyssolobium dumosum E. Mey (BS 97); (2) a miscellaneous clade of African, Asian and American taxa
including species of Cionura Griseb., Gymnema R. Br,
Marsdenia, Ruehssia H. Karst. and Telosma (BS 93); and
(3) an Asian and Australasian clade including species of
Gongronema (Endl.) Decne., Marsdenia and the Hoya
group (BS 97). The Hoya group clade is strongly supported (BS 99) as including all accessions of Dischidia,
Hoya and Oreosparte, as well as one species of Marsdenia, M. ridleyi, sister to Oreosparte sp. 3 (BS 100).
Analysis 2: 54-taxon matrix (Fig. 4) — The inclusion of
four additional loci resulted in greater resolution and support for relationships within the Hoya group than in the
110-taxon matrix (compare Fig. 3 and 4), and the topology of the Hoya group will be discussed based on the
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
combined chloroplast and nuclear analysis (Fig. 4). To
facilitate comparison, for the Hoya clades, we used the
clade names of Wanntorp & al. (2014: fig. 3, 4) and highlighted the species that they sampled in bold italics in our
Fig. 4.
Three taxa, including Hoya urniflora and two putative
Oreosparte species form a strongly supported, monophyletic (BS 100) clade (Oreosparte I), sister to the rest
of the taxa in the Hoya group that form a moderately supported clade (BS 79). Within this clade, four strongly to
moderately supported clades can be recognized. The first
(Oreosparte II, BS 100) includes the type of Oreosparte
as well as Marsdenia ridleyi and another putative Oreosparte sp. 3.
Oreosparte II is sister, but without support, to Dischidia s.l., which is strongly supported as monophyletic
(BS 100). The Dischidia clade includes species originally
described in the segregate genera Dischidiopsis [Dischidia parasita (Blanco) Arshed & al., the type of Dischidiopsis] and Leptostemma [D. hirsuta (Blume) Steud. and
D. latifolia (Blume) Decne.], and species with morphology diagnostic of the segregate genus Conchophyllum
[D. astephana Scort. ex King & Gamble (= C. angulatum
Schltr.) and D. milnei]. Within Dischidia, there is strong
support for the monophyly of all ant-house-leaved species (D. sect. Ascidophora and D. sect. Conchophyllum)
(BS 97) and for a clade that includes all ant-house-leaved
species plus the Bornean endemic D. antennifera Becc.
and the widespread D. nummularia R. Br. (the type of
Dischidia) (BS 100). The latter two species have small,
ovate to orbicular leaves, resulting in a paraphyletic D.
sect. Dischidia. The two pitcher-leaved species, D. major
and D. vidalii Becc. (D. sect. Ascidophora), are weakly supported as sister taxa (BS 55). The widespread D.
acutifolia Maingay ex Hook. f. and D. tomentella Ridl.
(a limestone endemic from Thailand and N peninsular
Malaysia) are strongly supported as sister taxa (BS 99).
126
Rodda & al.: Phylogenetic studies in the Hoya group
Secamone alpinii
Secamone filiformis
Pervillaea tomentosa
100/100
93/63
Cibirhiza dhofarensis
Fockea edulis
Fockea multiflora
Fockeeae
Microloma tenuifolium
79/83
91/88
Metastelma schaffneri
Schubertia grandiflora
Araujia sericifera
100/98
98/96
100/99
100/100
Cynanchum ellipticum
95/82
Oxystelma bornouense
100/98
78/60
Vincetoxicum flexuosum
Pergularia daemia
Gomphocarpus physocarpus
Eustegia minuta Eustegieae
96/90
100/99
100/100
98/96
100/100
100/99
99/90
75/57
100/97
Conomitra linearis
Leptadenia hastata
Leptadenia arborea
Orthanthera albida
Orthanthera jasminiflora
100/100
Neoschumannia cardinea
Neoschumannia kamerunensis
98/89
Riocreuxia torulosa
Riocreuxia burchellii
94/95
Anisotoma cordifolia
Sisyranthus compactus
75/Sisyranthus trichostomus
Sisyranthus virgatus
100/100
74/68
93/82
Asclepiadeae
Tylophora heterophylla
Ceropegieae
Ceropegia juncea
Ceropegia distincta
Ceropegia bulbosa
Quaqua incarnata
Caralluma arachnoidea
73/59
Apteranthes europaea
Boucerosia frerei
Ceropegia striata
99/96
Brachystelma pygmaeum
Riocreuxia burchellii
Stapelia rufa
59/Echidnopsis repens
Desmidorchis flavus
97/87
Rhyssolobium dumosum
African and Madagascan
Marsdenia verrucosa
Cionura erecta
Marsdenia rubicunda
93/84
Marsdenia tenacissima
Telosma accedens
Jasminanthes maingayi
62/50
Miscellaneous
Gymnema inodorum
100/94
73/55
63/59
Gymnema sylvestre
Ruehssia macrophylla
Marsdenia gillespieae
71/66
99/63 Ruehssia megalantha
Gongronema wallichii
Marsdenia flavescens
97/88
80/62
Marsdenia rostrata
Marsdenia coronata
72/52 Oreosparte sp. 2 (Papuahoya neoguineensis)
99/94 Oreosparte sp. 1 (Papuahoya bykulleana)
Hoya urniflora (Papuahoya urniflora)
74/58
Oreosparte celebica
91/81
Oreosparte sp. 3 (Oreosparte sabahensis)
99/93
100/96 Marsdenia ridleyi (Oreosparte parviflora)
Hoya imperialis
Hoya juhoneweana
95/64 Hoya hamiltoniorum
Hoya telosmoides
Hoya lasiantha
59/83/72 95/90
Hoya papaschonii
Hoya ignorata
63/64
Hoya corymbosa
Hoya manipurensis
84/73
Hoya carnosa
Hoya curtisii
Hoya caudata
79/66
Hoya spartioides
Hoya neoebudica
95/91
Hoya nicholsoniae
98/97
Hoya verticillata
Hoya lambii
Hoya thailandica
98/98
Hoya edeni
Hoya chinghungensis
68/71
Asian/Australian
100/71 Hoya lanceolata
Hoya cumingiana
Hoya inflata
Hoya mariae
Hoya sp. Eriostemma section
Hoya cf. ciliata
Hoya omlorii
94/89
Hoya serpens
Hoya burmanica
Hoya collina
Hoya pallilimba
Hoya heuschkeliana
Anatropanthus borneensis (Hoya insularis)
Dischidia hirsuta
86/56
Dischidia rimicola
Dischidia tomentella
99/89
Dischidia latifolia
Dischidia parasita
Dischidia acutifolia
Dischidia antennifera
56/94/89
Dischidia nummularia
Dischidia astephana
91/84
-/53
Dischidia vidalii
Dischidia major
82/66
0.0060
Dischidia milnei
96/88
Marsdenieae
Fig. 3. Maximum likelihood tree of the 110-taxon matrix of trnT-trnL-trnF sequences. Bootstrap support below the branches is
shown as ML/parsimony; “−” indicates that the clade does not occur in the strict consensus of most parsimonious trees.
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Willdenowia 50 – 2020
127
Hoya urniflora (Papuahoya urniflora)
87/53
100/100
Oreosparte sp. 1 (Papuahoya bykulleana)
Oreosparte I (Papuahoya)
Oreosparte sp. 2 (Papuahoya neoguineensis)
Oreosparte celebica
100/99
Oreosparte II
Marsdenia ridleyi (Oreosparte parviflora)
Oreosparte sp. 3 (Oreosparte sabahensis)
100/100
57/-
Dischidia acutifolia
99/97
Dischidia tomentella
Dischidia parasita
72/100/100
100/100
Dischidia latifolia
Dischidia sect. Dischidia
Dischidia hirsuta
100/100
51/-
Dischidia rimicola
Dischidia antennifera
Dischidia nummularia
54/-
84/52
100/100
Dischidia milnei
Dischidia astephana
97/95
Dischidia vidalii
Dischidia major
57/68
55/72
Hoya thailandica
Hoya edeni
100/100
100/99
Hoya chinghungensis
Hoya sp. Eriostemma section
100/98
79/55
Clade II
Hoya cf. ciliata
94/93
Hoya omlori
Hoya mariae
100/100
56/99/94
100/99
53/-
Clemensiella
Hoya telosmoides
Hoya hamiltoniorum
Clade III
Hoya lasiantha
Hoya papaschonii
100/100
Group 1
Hoya cumingiana
Hoya imperialis
69/54
-/-
Clade J
Hoya inflata
62/70
80/-
Clade I
Hoya lanceolata
100/99
ant-house-leaved
species
Clade IV
Hoya juhoneweana
Hoya ignorata
100/100
Clade X
Hoya corymbosa
99/76
Hoya collina
Anatropanthus borneensis (Hoya insularis)
100/99
Group 2
86/66
88/93/94
98/88
Hoya pallilimba
Clade V
Hoya heuschkeliana
Hoya serpens
Hoya burmanica
Clade M
68/-
Hoya manipurensis “Clade P”
Hoya carnosa
100/85
Hoya spartioides “Clade P”
Hoya curtisii “Clade P”
82/53
Clade VI
Hoya caudata
Hoya nicholsoniae
Hoya neoebudica
100/100
Hoya verticillata
Hoya lambii
Jasminanthes maingayi
83/72
Marsdenia flavescens
Marsdenia rostrata
Outgroups
0.006
Fig. 4. Maximum likelihood tree of the combined chloroplast and nuclear 54-taxon matrix. Clade and group names follow Wanntorp & al. (2014) except “clade X”, which corresponds to clade 8 of Rodda & al. (2013) and the novel Clemensiella clade. Species
sampled by Wanntorp & al. (2014) are in bold italics. Bootstrap support below the branches is shown as ML/parsimony; “−” indicates that the clade does not occur in the strict consensus of most parsimonious trees.
Dischidia parasita, endemic to the Philippines, is sister
to D. latifolia (BS 100), distributed in Borneo and Java.
Other relationships are weakly to moderately supported.
Dischidia and Oreosparte II are sister, but without
support, to a clade (clade 1, BS 100) including Hoya species from continental Asia that, with the exception of H.
thailandica Thaitong, are non-climbing pendulous shrubs.
The rest of Hoya forms a moderately supported clade
(BS 80) where eight of the subclades identified by Rodda
& al. (2013) and Wanntorp & al. (2014) can be delimited.
However, clade J has only one species, H. cumingiana
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Decne, and H. imperialis Lindl. is not included in any
clade. All but clade IV are moderately to strongly supported.
Two main subclades can be recognized: the unsupported group 1 (BS 53) and the well-supported group 2
(BS 99). Group 1 includes clades II, III, and IV plus clade
J and Clemensiella. Clade II (BS 100) comprises terrestrial climbers from Sundaland, Papua and the Philippines
classified in Hoya sect. Eriostemma. Clade II is sister to
the Clemensiella clade (BS 100) and includes two species,
H. mariae (Schltr.) L. Wanntorp & Meve and H. omlorii
128
(Livsh. & Meve) L. Wanntorp & Meve, formerly classified in the segregate genus Clemensiella. Group 1 also
includes clade III (BS 100) with two Borneo endemics, H.
hamiltoniorum A. L. Lamb & al. and H. telosmoides Omlor, as well as two shrubby species, H. lasiantha (Korth.
ex Blume) Miq. and H. papaschonii, all distributed in W
Malesia. A moderately supported clade consisting of species placed in clades IV and J by Wanntorp & al. (2014)
(BS 69) includes two Sundaland species and two Papua
endemics, H. inflata (P. I. Forst. & al.) L. Wanntorp & P.
I. Forst. (originally described in the synonymized genus
Madangia) and H. juhoneweana Simonsson & Rodda.
Group 2 includes four subclades: clade X (clade 8 of
Rodda & al. 2013) and clades V, M and VI. The Borneo
endemic H. corymbosa and the widespread H. ignorata
T. B. Tran & al. form clade X (BS 100), not sampled by
Wanntorp & al. (2014). Forming clade V (BS 100) are
H. heuschkeliana Kloppenb. and H. pallilimba Kleijn &
Donkelaar, both classified in H. sect. Acanthostemma, the
former endemic to the Philippines, the latter endemic to
Sulawesi, plus H. collina Schltr. from Papua and Anatropanthus borneensis. Clade M (BS 93) includes two montane species from continental Asia and is sister to clade VI
(BS 100), which includes two very widely distributed species, H. nicholsoniae F. Muell. and H. verticillata (Vahl)
G. Don, plus species described in the segregate genera
Absolmsia (H. spartioides (Benth.) Kloppenb.) and Micholitzia (H. manipurensis Deb). “Clade” (actually grade)
P of Wanntorp & al. (2014) falls within clade VI in the
present analysis (Fig. 4) rather than clade VI being nested
in grade P as in Wanntorp & al. (2014).
Discussion
This study is the best-sampled analysis of the morphological and taxonomic diversity of the Hoya group conducted to date, including for the first time the enigmatic
Anatropanthus and Oreosparte. The 110-taxon analysis
(Fig. 3) is completely congruent with the tribal-level topology published by Meve & Liede (2004) and clearly
shows that the Hoya group clade (BS 99), including Anatropanthus, Dischidia s.l., Hoya s.l. and Oreosparte, is
nested within Marsdenieae in a clade with other Asian
and Australasian species. The Hoya group is paraphyletic
unless one Marsdenia species (M. ridleyi) is included. By
increasing sampling of Marsdenia s.l. from six to 11 species, our result also highlights the polyphyly of the current concept of Marsdenia s.l. (Forster 1995). Marsdenia
species are placed within: (1) the Hoya group (M. ridleyi,
now Oreosparte parviflora, and M. urniflora, now Papuahoya urniflora); (2) an Asian/Australian clade outside
the Hoya group (M. coronata Benth, M. flavescens and
M. rostrata); (3) an African and Madagascan clade (M.
verrucosa); and (4) a miscellaneous clade (two Marsdenia species from tropical Asia and M. gillespieae Morillo, which will have to be moved to the recently resur-
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Rodda & al.: Phylogenetic studies in the Hoya group
rected Ruehssia; Espírito Santo & al. 2019). We have not
sampled the type of Marsdenia, M. tinctoria R. Br., and
will not discuss the taxonomic implications at this time
except for the obvious necessity to transfer M. ridleyi to
a genus within the Hoya group. This species is epiphytic
with persistent inflorescences and valvate corolla lobes,
all synapomorphies of the Hoya group.
Hoya group phylogeny and taxonomy — Generic delimitation within the Hoya group (Fig. 4) remains problematic. Our analysis shows much the same topology, with
the exception of “clade P” sensu Wanntorp & al. (2014)
nesting within clade VI (Fig. 4), and the same ambiguities, evident in the studies previously published using
the same loci (Wanntorp & al. 2006; Wanntorp & al.
2011; Rodda & al. 2013; Rodda & Ercole 2014; Wanntorp & al. 2014). Dischidia s.l. is strongly supported as
monophyletic (BS 100), but Hoya s.l. is unsupported. To
complicate matters further, Oreosparte celebica and the
species with “Oreosparte floral phenotype” sampled do
not form a monophyletic clade but are subdivided into
two clades. Clade Oreosparte I is sister to the rest of
the Hoya group and includes H. urniflora and two new
species from Papua New Guinea. Clade Oreosparte II
is sister to Dischidia (Fig. 4) and includes the type of
the genus as well as M. ridleyi and a new species from
Borneo. Our analysis provides strong evidence that the
“Oreosparte floral phenotype” has also evolved independently in H. hamiltoniorum within clade III of Hoya
s.l. The floral morphology of the former Clemensiella
species is also very similar (Meve & al. 2009). While
this lack of resolution among the primary branches of the
Hoya group clade has been interpreted as evidence of a
rapid radiation (Wanntorp & al. 2014), it may also be a
matter of insufficient character sampling. For example,
the position of Eustegieae had been controversial based
on molecular matrices of few loci such as this one (sister
to Ceropegieae plus Marsdenieae, BS 75, Fig. 3) or sister
to Asclepiadeae (BS 76) (Surveswaran & al. 2014), but
was resolved with high support as sister to Asclepiadeae
in a plastome analysis (Straub & al. 2013). Taxonomic
undersampling may also contribute to the lack of support
(Zwickl & Hillis 2002). While we have sampled the geographic and morphological diversity of Hoya s.s., we still
may not have sampled all early-diverging lineages, and
we have not sampled Heynella.
Oreosparte I and Oreosparte II are separated geographically, the first from Papua New Guinea, the second
from West Malesia. Additionally, species of Oreosparte
II have bifid corona lobe apices, whereas species of Oreosparte I have entire corona lobe apices. We therefore recognize Oreosparte I as the new genus, Papuahoya Rodda
& Simonsson.
Because of the lack of support for relationships among
Oreosparte I and the Dischidia and Hoya clades, we consider the evidence insufficient for placing Oreosparte and
Dischidia in synonymy with Hoya s.l. (Fig. 4).
Willdenowia 50 – 2020
Anatropanthus borneensis is nested within Hoya
clade V with high support (Fig. 4). Its tubular corolla is
very unusual, but corollas in Hoya can be particularly
diverse and new species with unusual corollas are still
being discovered, e.g. H. versteegii Simonsson & Rodda
from New Guinea is the first species in the genus with an
infundibuliform corolla with a long, narrow tube. Other
characters of Anatropanthus are already found among
Hoya species. The long, linear leaves of A. borneensis are
similar to those of H. acicularis T. Green & Kloppenb.,
also from Borneo; the recurved pedicels are similar to
those of H. retrorsa; and the pollinia have an evident
pellucid margin, as commonly observed in the majority
of Hoya species. Anatropanthus borneensis is therefore
transferred here to Hoya.
Dischidia phylogeny and taxonomy — Phylogenetic relationships within Dischidia are congruent with those
found by Livshultz (2003b) in an analysis of the nuclear
second Leafy intron. Aside from the relationships of the
ant-house-leaved species, discussed above, the phylogeny supports the recognition of Dischidia s.l., including
the synonymized genera Conchophyllum (D. astephana,
morphology similar to D. milnei), Dischidiopsis (D. parasita), Leptostemma (D. hirsuta, D. latifolia) and Oistonema (morphology similar to D. latifolia), erected on the
basis of atypical corona morphologies. The division into
three sections based on leaf morphology is also not supported because both D. sect. Conchophyllum and D. sect.
Dischidia are paraphyletic (Fig. 4). The sister-group relationship of two laminar-leaved species, D. antennifera
and D. nummularia, with the ant-house-leaved clade (BS
100) is supported by a potential vegetative synapomorphy: presence of prominent wax chimneys around the stomata, particularly evident on the abaxial leaf surfaces, and
a diagnostic floral character: absence of papillate epidermal cells on the adaxial surface of the corolla lobes. The
sister-group relationship of D. latifolia and D. parasita
is congruent with a number of morphological characters.
Both species are relatively robust vines with larger leaves
(compared to most other Dischidia species) with both opposite and alternate phyllotaxis; other potential synapomorphies include fleshy corona lobes with abaxial sulci
and pollinaria with very short caudicles. While the larger
clade that includes these two species plus D. acutifolia and
D. tomentella is weakly supported (BS 72), it is consistent
with the presence of alternate phyllotaxy in seedlings of
D. acutifolia. Dischidia acutifolia and D. tomentella have
similar floral and inflorescence morphology. Dischidia
tomentella is endemic to karst in N Malaysia and S Thailand (Rintz 1980), often growing epilithically on exposed
rock surfaces rather than epiphytically (Livshultz, pers.
obs.). It may have evolved from isolated populations of
the widespread, lowland species D. acutifolia that adapted
to the more challenging edaphic conditions on karst via
evolution of smaller, more succulent leaves, greater pubescence and slower growth.
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
129
Hoya s.l. phylogeny and taxonomy — Eight of the nine
clades recognized in Hoya (Fig. 4) were also identified by
Wanntorp & al. (2014). Hoya corymbosa and H. ignorata,
forming clade X, were not sampled by Wanntorp & al.
(2014). Our sampling of Hoya species is insufficient to provide a strong basis for an updated subgeneric classification
of the genus, but five already recognized sections can be
identified. Clade I corresponds to H. sect. Ancistrostemma
and includes its type, H. edeni King ex Hook. f. Clade II
corresponds to H. sect. Eriostemma. Clade III corresponds
to H. sect. Plocostemma and includes its type, H. lasiantha. Clade V corresponds to H. sect. Acanthostemma. The
morphologically diverse clade VI includes the type of H.
sect. Hoya, H. carnosa. Four clades do not represent any
of the currently recognized sections: (1) the Clemensiella
clade, including the two species formerly included in that
genus; (2) clade IV, including three Papuan species; (3)
clade X with the shrubby H. corymbosa and H. ignorata;
and (4) clade M, with two Asian representatives. A much
more comprehensive sampling including the type species
of all the sections and subsections described so far would
be necessary to verify whether any of these four clades
represent a published infrageneric entity.
Conclusions
Our analysis is the first to include a comprehensive sampling of Anatropanthus, Dischidia, Hoya and Oreosparte
without a significant amount of missing data, as well as
numerous outgroups, in a comprehensive phylogenetic
analysis. Anatropanthus is strongly supported as nested
in Hoya within clade V (Fig. 4) and is here transferred to
Hoya as H. insularis.
The available data show once again that Hoya is paraphyletic unless Dischidia and Oreosparte are synonymized
(Fig. 4). However, the relationships among Hoya and
Oreosparte clade II and Dischidia s.l. are not supported.
Current evidence is not sufficient to synonymize Dischidia
and Oreosparte with Hoya. A phylogenomic approach is
needed to clarify relationships among these taxa.
Oreosparte is strongly supported as belonging to the
Hoya group (Fig. 3), but its species are separated into
two clades, one of which is described as a new genus,
Papuahoya. The Hoya group is placed within a grade of
Asian and Australasian Marsdenieae (Fig. 3). Our results underline the polyphyly of the current concept of
Marsdenia (Fig. 3).
Taxonomy
Hoya insularis Rodda & S. Rahayu, nom. nov. (Fig. 2)
≡ Anatropanthus borneensis Schltr. in Bot. Jahrb. Syst.
40(Beibl. 92): 18. 1908 [non Hoya borneoensis Kloppenb. in Hoya New 8(3): 10. 2018]. – Type: Borneo, auf
Bäumen in den Wäldern am Long-Sele, an höher gele-
130
Rodda & al.: Phylogenetic studies in the Hoya group
Description — Epiphytic climber (occasionally hemi-epiphytic in mossy forest),
with white latex in all vegetative parts.
Roots basal and adventitious. Stems pubescent. Stipular colleters present, 1 at
each side of base of petiole. Lamina lanceolate to ovate, stiff and chartaceous, pubescent turning glabrescent on old leaves,
basal colleters present; venation pinnate.
Inflorescences 1 per node, extra-axillary,
convex, consisting of (1 or)2–10 flowers, peduncle perennial, pubescent, older
inflorescences with an elongated rachis.
Pedicels all of same length within an inflorescence. Calyx lobes oblong, free; colleters present in calyx lobe sinus. Corolla
campanulate to urceolate, terminating in
free, spreading lobes; lobes triangularlanceolate, valvate in bud. Gynostegium
shortly stipitate. Corona staminal; lobes
erect, almost completely fused to back
of anthers, basal part of corona lobe globose or indistinct, without revolute basal
margins, apical part of corona lobe acute
with a rounded tip. Style-head conic, hidden by apical anther appendages. Pollinia
oblong, without pellucid margin; corpusculum ovoid; caudicles attached at base of
corpusculum. Ovary conic. Fruit and seeds
not observed.
Remarks — The “Oreosparte floral phenotype”, i.e. presence of urceolate corollas
Fig. 5. Papuahoya bykulleana. – A: inflorescence with an opening bud and a
and stipitate gynostegia with erect corona
fully open flower; B: habit. – Scale bars: A = 5 mm; B = 2 cm. – Vouchered by
lobes, is present in the Clemensiella clade
Simonsson Juhonewe & Juhonewe NS0029B. – Photographs by N. Simonsson.
and clade III of Hoya, Oreosparte and Pagenen Orten, Aug 1901, R. Schlechter 13483 (B [depuahoya. Both Oreosparte and Papuahoya
stroyed]). – Lectotype (designated here): [icon] “Fig. are epiphytic climbers and the only reliable morphologi2. Anatropanthus borneensis Schltr. n. sp.” in Bot. Jahrb. cal character for the separation of the two genera is the
Syst. 40(Beibl. 92): t. 2 ad p. 18. 1908.
different morphology of the corona lobe apices, which
are bifid in Oreosparte and simple in Papuahoya. The
Remarks — The type specimen of Anatropanthus borne- species in the Clemensiella clade also have simple corona
ensis was lost in the fire that destroyed the Berlin Her- lobe apices, but they are terrestrial climbers.
barium in 1943 (Omlor 1998). No duplicates have been
traced and it is likely that only a single specimen was Papuahoya bykulleana Simonsson & Rodda, sp. nov. –
made — Schlechter (1908) stated “I found very little mate- Fig. 5, 6.
rial in bloom”. The illustration in the protologue (Schlech- Holotype: Papua New Guinea, Morobe Province, Faseu,
ter 1908: t. 2) is therefore designated as the lectotype.
1574 m, 23 Feb 2011, N. Simonsson Juhonewe & F.
Juhonewe NS0029B (SING [incl. spirit]; isotype: LAE).
Specimens examined — Thailand: cultivated, 2018,
Somadee s.n. (SING). — Indonesia: originally collect- Description — Slender, creeping climber. Stems cylined in West Kalimantan by Sulaiman Hasim, cultivated in dric, 1 – 3 mm in diam., mid-green, pubescent; older stems
Bogor Botanic Garden, 2017, Rahayu 877 (BO).
glabrescent, internodes 2 – 10(– 20) cm long; adventitious
roots sparsely present along stem. Leaves: petiole terete,
Papuahoya Rodda & Simonsson, gen. nov.
1.5 – 4 × c. 1 mm, bright green, pubescent; lamina coType: Papuahoya bykulleana Simonsson & Rodda – Fig. riaceous, broadly ovate-elliptic, 2 – 5 × 1 – 2.5 cm, pale
5, 6.
green on abaxial surface, bright green on adaxial sur-
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Willdenowia 50 – 2020
131
Fig. 6. Papuahoya bykulleana. – A: fully open flower, top view; B: opening bud, side view; C, D: gynostegium, side view; E: gynostegium, from below; F: calyx and ovary; G: pollinarium. – Drawn by M. Rodda, based on Simonsson Juhonewe & Juhonewe
NS0029B.
face, pubescent on both surfaces, base rounded to acute,
margin recurved, apex broadly acute to caudate; midrib
depressed on adaxial surface, secondary veins 2 – 6 on
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
each side, branching from midrib at 70 – 80°, slightly depressed, creating a bullate surface. Inflorescence ageotropic, consisting of 1 or 2 flowers; peduncle persistent,
132
terete, 0.5 – 2 cm × 1 – 1.5 mm, older peduncles bearing
an elongate rachis from previous flowerings, often darker
green or purplish, pubescent; pedicels terete, 0.5 – 1.5 cm
× c. 1 mm, dark green to purplish red, slightly pubescent.
Flower buds valvate, snow-white, often flushed pink near
calyx if exposed to strong light. Calyx lobes lanceolate,
c. 2 × 1 mm, outside sparsely pubescent, inside glabrous,
apex rounded to acute. Corolla narrowly campanulate
with free, spreading lobes, 1.5 – 2 cm in diam.; tube 4 – 5
× 3 – 4 mm, snow-white, flushed pink on outside near
calyx, outside glabrous, inside pubescent, with longer
hairs around mouth; lobes lanceolate, often twisted, 6 – 9
× 2 – 3 mm, outside glabrous, inside pubescent only basally, margin recurved to revolute, apex acute. Corona
staminal, ovoid, c. 5 mm high, 3 – 4 mm in diam., fleshy,
white; lobes erect, oblong, c. 3 mm × 1 mm, with 1 deep,
central groove along entire length, basal part of corona
lobe deeply grooved, without appendages, apical part of
corona lobe acute with a rounded tip. Style-head convex, exposed. Pollinia oblong, 300 – 350 × 70 – 80 μm;
corpusculum ovate, 210 – 250 × 110 – 140 μm; caudicles
c. 50 µm. Ovary 2-carpellate, broadly conic, c. 1.5 mm
long; each carpel c. 1 mm wide at base, light green, glabrous. Fruit and seeds not observed.
Distribution — Known only from the type locality in
Morobe Province of Papua New Guinea.
Ecology — Recorded at 1500 – 1700 m on two ridges
in primary mossy forests, where it grows on mossy
ground, at the base of tree trunks near the ground or
as an epiphyte. Papuahoya bykulleana is often hemiepiphytic as it starts growing in mossy areas, at the
base of a tree or on moss-covered shrubs and continues
growing tightly attached onto the tree trunk, or climbing on small shrubs, upward toward better-lit areas. It is
absent either further up or down the mountain, even on
the same slope.
Etymology — Named after Gunilla Bykulle of Sweden,
who contributes to N. Simonsson’s work in Papua New
Guinea.
Remarks — Similar to Papuahoya neoguineensis in being a slender, pubescent climber with campanulate flowers with lanceolate corolla lobes. It is easily distinguished
because its corona is ovoid with erect, oblong lobes without a distinct basal process, whereas P. neoguineensis has
a conic corona with lobes with a rounded and spreading
basal process. Both taxa were found in Morobe Province
but on separate mountain ranges c. 110 km apart and at
different altitudes, 1500 – 1700 m for P. bykulleana and
c. 800 m for P. neoguineensis.
Additional specimens examined — Papua New Guinea: Morobe Province: Faseu, c. 1700 m, vouchered at
Ukarumpa on 13 Nov 2012 from living accession NS12-
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Rodda & al.: Phylogenetic studies in the Hoya group
018, N. Simonsson Juhonewe & F. Juhonewe NS0058L
(LAE); Faseu, c. 1700 m, vouchered at Ukarumpa on 13
Nov 2012 from living accession NS12-026, N. Simonsson Juhonewe & F. Juhonewe NS0059L (LAE).
Papuahoya neoguineensis Simonsson & Rodda, sp. nov.
– Fig. 7.
Holotype: Papua New Guinea, Morobe Province, Lababia, Kamiali Wildlife Management Area, on ridge trail to
Blue Mountain, mossy forest on ultrabasic soil, c. 800 m,
15 Jul 2011, S. A. James & O. Paul s.n., vouchered at
Ukarumpa on 26 Apr 2015 from living accession NS13013, N. Simonsson Juhonewe & F. Juhonewe NS0103L
(SING; isotype: LAE).
Description — Slender creeping climber. Stems cylindric, 1 – 2 mm in diam., green, pubescent; older stems
glabrescent, lignified, up to 4 mm in diam., internodes
2 – 10(– 20) cm long; adventitious roots produced along
stem when in contact with substrate. Leaves: petiole
terete, 1.5 – 10 × c. 1 mm, green, pubescent on both
sides; lamina broadly ovate-elliptic, coriaceous, 2 – 5 ×
1 – 2.5 cm, silvery to pale green on abaxial surface, bright
to dull green on adaxial surface, often with purplish
hue in bright light, pubescent on both surfaces, turning glabrescent, base rounded to acute, margin sometimes recurved, apex broadly acute to cuspidate; midrib
depressed on adaxial surface, often brighter coloured,
secondary veins 2 – 6 on each side, branching from midrib at 70 – 80°. Inflorescence ageotropic, consisting of
1 or 2 flowers; peduncle persistent, terete, 0.2 – 1 cm ×
1 – 1.5 mm, older peduncles bearing an elongate rachis
from previous flowerings, often darker green or purplish, pubescent; pedicels terete, c. 1 cm × 1 mm, green
to purplish red, sparsely pubescent. Flower buds valvate,
creamy white-yellow, basally flushed pink. Calyx lobes
broadly triangular, c. 1 × 1.5 mm, apex rounded, glabrous to sparsely pubescent outside, with a hump at base
of each lobe on outside. Corolla campanulate, 2 – 2.4 cm
in diam., creamy white-yellow, flushed pink on outside
near calyx if under bright light; tube c. 4 × 5 – 7 mm, glabrous outside, pubescent inside with short hairs; lobes
narrowly triangular, often fleshy, 8 – 9 × c. 5 mm, outside
glabrous, inside pubescent, margin recurved, apex acute.
Corona staminal, c. 5 mm high, c. 5 mm in diam., fleshy,
yellow; lobes 4 – 5 mm long, with 1 deep, central groove
along entire length, basal part of corona lobe spreading,
rounded, apical part of corona lobe erect, acute. Stylehead convex, exposed, c. 1 mm in diam. Pollinia oblong,
300 – 350 × 70 – 100 μm; corpusculum ovate, 200 – 250 ×
180 – 220 μm; caudicles 70 – 90 µm long. Ovary 2-carpellate, conic, c. 2 mm long; each carpel c. 0.7 mm wide
at base, light green, glabrous. Fruit and seeds not observed.
Distribution — Known only from the type locality in
Morobe Province of Papua New Guinea.
Willdenowia 50 – 2020
133
Fig. 7. Papuahoya neoguineensis. – A: habit, in cultivation; B: fully open flower, top view; C: fully open flower, side view; D: gynostegium, side view; E: pollinarium. – Scale bars: A = 1 cm; B – D = 5 mm; E = 500 μm. – Vouchered by Simonsson Juhonewe &
Juhonewe NS0103L. – Photographs: A – D by N. Simonsson; E by M. Rodda.
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
134
Ecology — Papuahoya neoguineensis was collected as a
sterile cutting in primary mossy forest along a ridge on
ultrabasic soil, at about 800 m.
Etymology — Named after the island of New Guinea,
where the genus Papuahoya is endemic.
Additional specimen examined — Papua New Guinea:
Morobe Province: Lababia, c. 800 m, vouchered at Singapore Botanic Gardens on 23 Apr 2015 from living accession NS13-013, Rodda MR1116 (SING).
Papuahoya urniflora (P. I. Forst.) Rodda & Simonsson,
comb. nov. ≡ Marsdenia urniflora P. I. Forst. in Austral.
Syst. Bot. 8: 752. 1995 ≡ Hoya urniflora (P. I. Forst.)
Simonsson & Rodda in Gard. Bull. Singapore 69: 137.
2017. – Lectotype (designated by Rodda & Simonsson
Juhonewe 2017: 137): Papua New Guinea, Oro Province, Lala River, c. 5500 ft. [c. 1675 m], 28 Dec 1935,
C. E. Carr 14065 (SING [SING0122003]; isolectotypes: BM [BM001014154], K, L, SING [SING122001,
SING122002]).
Remarks — Papuahoya urniflora is fully described and
illustrated in Rodda & Simonsson Juhonewe (2017).
Oreosparte parviflora (Ridl.) Rodda & Simonsson,
comb. nov. ≡ Stephanotis parviflora Ridl. in J. Straits
Branch Roy. Asiat. Soc. 57: 69. 1911 ≡ Marsdenia ridleyi
P. I. Forst. in Austral. Syst. Bot. 8: 700. 1995, nom. illeg.
superfl. – Lectotype (designated by Forster 1995: 700):
Malaysia, Perak, Tapah, Tenok road, 1908, H. N. Ridley
s.n. (SING [SING0072733]).
Additional specimens examined — Malaysia: Perak,
Ulu Temango, Jul 1909, H. N. Ridley s.n. (SING
[SING007274]); Terengganu, Kemaman, Bukit Kajang,
26 Nov 1936, Corner 30564 (SING).— Singapore: cultivated plant vouchered at Singapore Botanic Gardens, 16
Aug 2016, Rodda MR1786 (SING).
Oreosparte sabahensis Rodda & Simonsson, sp. nov. –
Fig. 8.
Holotype: Malaysia, Sabah, Tawau, Hoya River, Merotai
Kanan, 18 Feb 2002, S. Dolois, J. Yabainus, G. Masius &
J. Gusili SNP16224 (SNP; isotype: SNP).
Description — Climber with white latex in vegetative
parts. Roots unknown, no evidence of adventitious roots.
Stems cylindric, 4 – 6 mm in diam., sparsely pubescent,
older parts glabrous, internodes 10 – 25 cm long. Leaves:
petiole terete, channelled adaxially, 1.5 – 2(– 2.5) cm ×
2 – 3 mm, pubescent turning glabrescent; lamina broadly
elliptic to ovate, coriaceous when dry, 4 – 8 × 3 – 5 cm,
pubescent or sparsely pubescent on young leaves only,
older leaves glabrescent, with sparse hairs along abaxial midrib, base rounded and slightly peltate, margin
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Rodda & al.: Phylogenetic studies in the Hoya group
slightly recurved, apex acute; penninerved but with 2
prominent, basal secondary veins, midrib depressed on
adaxial surface, secondary veins 2 or 3 per side, branching from midrib at 30 – 45°. Inflorescences consisting of
1 or 2 flowers, often with only 1 flower open at a time;
peduncle terete, persistent, extra-axillary, (0.7 –)6 – 8 cm
× 3 – 5 mm, pubescent on young peduncles only; rachis
unbranched, thicker than peduncle, 5 – 6 mm in diam.;
pedicels terete, 3 – 5 × c. 2 mm, sparsely pubescent.
Calyx lobes ovate or triangular, c. 4 × 2 mm, sparsely
puberulent outside, with 2 or 3 basal colleters at each
lobe sinus, apex rounded or acute, ciliate. Corolla campanulate, with a contracted throat and free, spreading
lobes, white or yellow, (2 –)3 – 3.5 cm in diam.; tube
5 – 6 × 6 – 7 mm, outside glabrous, inside minutely pubescent at throat; lobes triangular to ovate, (7 –)11 – 15 ×
5 – 7 mm, glabrous, apex acute, laterally reflexed. Gynostegium stipitate; stipe 1.5 – 2 mm high. Corona staminal,
conic, just exceeding corolla tube, 3.5 – 4.5 × 3 – 4 mm,
corona lobes erect, triangular, c. 4 × 2 mm, basal part
of corona lobe truncate, with a spreading margin, apical
part of corona lobe bifid, slightly exceeding style-head.
Style-head radially 5-lobed, apically bilobed, papillate.
Pollinia erect, clavate, 1100 – 1200 × 350 – 500 µm; corpusculum ovate, c. 1000 × 550 µm, brown; caudicles
simple, attached at base of corpusculum, 400 – 450 ×
100 – 110 µm. Fruit follicles (unripe) paired, each follicle
held at a c. 45° angle from pedicel, recurved, c. 2.5 ×
0.6 – 0.7 cm, densely pubescent; seeds (unripe) flattened,
ciliate from mid-portion to chalazal end, long comose at
micropylar end.
Distribution — Known only from two collections in
Sabah, Malaysia. The species was also seen in Kalimantan (Indonesia) (Rahayu, pers. obs.), but no specimens
were obtained.
Ecology — The only available habitat information gathered from the type specimen is that the species was found
growing along a river bank, likely as an epiphytic climber. The other specimen known (Aban & al. SAN86905,
SAN) was collected in lowland dipterocarp forest.
Etymology — Named after the Malaysian state of Sabah,
where the type specimen was collected.
Remarks — Oreosparte sabahensis is vegetatively similar to O. parviflora because both species have broadly
elliptic to ovate leaves and rather stout peduncles. The
two species can be separated by O. parviflora having a
very pubescent corolla throat (vs. minutely pubescent in
O. sabahensis) and a divergent apical part of the corona
lobe (vs. convergent in O. sabahensis).
Additional specimen examined — Malaysia: Sabah,
Sandakan, Sepilok Forest Reserve, 18 Aug 1977, Aban,
Henry & J. Nasip SAN86905 (SAN).
Willdenowia 50 – 2020
135
Fig. 8. Oreosparte sabahensis. – A: fully open flower, top view; B: flower, side view, with part of corolla removed exposing gynostegium; C, D: gynostegium, side view; E: gynostegium, from below; F: calyx and ovary; G: pollinarium. – Drawn by M. Rodda,
based on Dolois & al. SNP16224.
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
136
Acknowledgements
This study is part of an ongoing research project on
the systematics of Asian Apocynaceae. Michele Rodda
received financial support from the National Parks
Board (Singapore), which sponsored numerous herbarium study trips to Asian and European institutions
and extensive fieldwork as well as lab work. Nadhanielle Simonsson received support from the Yves Rocher
Foundation, Helge Ax:son Johnsons stiftelse and many
individual contributors. The curators of the herbaria A,
BISH, BK, BKF, BM, BRUN, FI, G, HBG, IBSC, K,
KEP, KUN, L, M, MO, P, SAN, SAR, SING, SNP, TO,
UC, US, W and WRSL are thanked for allowing access
to their collections and/or allowing loans or providing high-quality images of herbarium specimens. Rimi
Repin (SNP), Lesley Scott and Suzanne Cubey (E) are
thanked for allowing destructive sampling of herbarium
specimens. Kampon Tansacha and Anders Lindstrom
are thanked for allowing access to the extensive Hoya
living collection at Nong Nooch Tropical Botanical
Garden (Thailand). Sulaiman Hasim (Pontianak, Indonesia) is thanked for sending a sample of H. insularis
to Bogor Botanic Garden. Loh Xiang Yun is thanked
for preparing the illustration of Hoya insularis. David
Goyder (Royal Botanic Gardens, Kew) and Ulrich
Meve (Lehrstuhl für Pflanzensystematik, Universität
Bayreuth) are thanked for their comments on an earlier
version of this article.
References
Bruyns P. V., Klak C. & Hanáček P. 2015: Recent radiation of Brachystelma and Ceropegia (Apocynaceae)
across the Old World against a background of climatic change. – Molec. Phylogen. Evol. 90: 49 – 66.
Burton C. M. 1985: Hoya sections. – Hoyan 7: 36 – 37.
Burton C. M. 1995: A tentative alternative arrangement
of Hoya sections. – Hoyan 17: 10 – 12.
Burton C. M. 1996a: A tentative alternative arrangement
of Hoya sections. – Hoyan 17: 14 – 18.
Burton C. M. 1996b: A tentative alternative arrangement
of Hoya sections. – Hoyan 18: 2 – 6.
Burton C. M. 1996c: A tentative alternative arrangement
of Hoya sections. – Hoyan 18: 9 – 13.
Cuénoud P., Savolainen V., Chatrou L. W., Powell M.,
Grayer R. J. & Chase M. W. 2002: Molecular phylogenetics of Caryophyllales based on nuclear 18S
rDNA and plastid rbcL, atpB, and matK DNA sequences. – Amer. J. Bot. 89: 132 – 144.
Endress M. E., Meve U., Middleton D. J. & LiedeSchumann S. 2019: Apocynaceae. – Pp. 207 – 411 in:
Kadereit J. W. & Bittrich V. (ed.), The families and
genera of vascular plants XV. Flowering plants. Eudicots. Apiales, Gentianales (except Rubiaceae). –
Cham: Springer.
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
Rodda & al.: Phylogenetic studies in the Hoya group
Espírito Santo F. da S. do, Rapini A., Ribeiro P. L.,
Liede-Schumann S., Goyder D. J. & Fontella-Pereira
J. 2019: Phylogeny of the tribe Marsdenieae (Apocynaceae), reinstatement of the genus Ruehssia and the
taxonomic treatment of the species from Brazil. –
Kew Bull. 74: 30 [1 – 79].
Forster P. I. 1995: Circumscription of Marsdenia (Asclepiadaceae: Marsdenieae) with a revision of the genus in Australia and Papuasia. – Austral. Syst. Bot.
8: 703 – 933.
Forster P. I. 2000: Rediscovery of Dischidia torricellensis (Schltr.) P.I.Forst., an unusual epiphytic asclepiad
from New Guinea. – Austrobaileya 5: 725 – 728.
Hiepko P. 1978: Die erhaltenen Teile der Sammlungen
des Botanischen Museums Berlin-Dahlem (B) aus
der Zeit vor 1943. – Willdenowia 8: 389 – 400.
Hooker J. D. 1885: Asclepiadeae. – Pp. 1 – 65 in: Hooker
J. D. (ed.), The flora of British India 4. – London: L.
Reeve & Co.
Khanum R., Surveswaran S., Meve U. & Liede-Schumann S. 2016: Cynanchum (Apocynaceae: Asclepiadoideae): a pantropical asclepiadoid genus revisited.
– Taxon 65: 467 – 486.
Kloppenburg R. D. 1993: Hoya sections. – Fresno: R. D.
Kloppenburg.
Kloppenburg R. D. 1994. Hoya sections. – Fraterna 1st &
2nd quarters: I – XXIV.
Larkin M. A., Blackshields G., Brown N. P., Chenna R.,
McGettigan P. A., McWilliam H., Valentin F., Wallace
I. M. Wilm A., Lopez R., Thompson J. D., Gibson T.
J. & Higgins D. 2007: Clustal W and Clustal X version 2.0. – Bioinformatics 23: 2947 – 2948.
Liede-Schumann S., Kong H. H., Meve U. & Thiv M.
2012: Vincetoxicum and Tylophora (Apocynaceae:
Asclepiadoideae: Asclepiadeae) – two sides of the
same medal: independent shifts from tropical to temperate habitats. – Taxon 61: 803 – 825.
Livshultz T. 2003a: Lectotypification of Dolichostegia
Schlechter (Asclepiadoideae, Apocynaceae) and a
new combination, Dischidia boholensis. – Taxon 52:
595 – 600.
Livshultz T. 2003b: Systematics of Dischidia (Apocynaceae, Asclepiadoideae). – Ithaka: Ph.D. thesis,
Cornell University.
Livshultz T, Tran T. B., Bounphanmy S. & Schott D.
2005: Dischidia (Apocynaceae, Asclepiadoideae) in
Laos and Vietnam. – Blumea 50: 113 – 134.
Meve U., Laurente O., Alejandro G. J. & Livshultz T.
2009: Systematics of Clemensiella (ApocynaceaeAsclepiadoideae). – Edinburgh J. Bot. 66: 447 – 457.
Meve U. & Liede S. 2004: Subtribal division of Ceropegieae (Apocynaceae – Asclepiadoideae). – Taxon
53: 61 – 72.
Miquel F. A. W. 1856: Hoya. – Pp. 516 – 527 in: Miquel
F. A. W. (ed.), Flora van Nederlandsch Indië 2. – Amsterdam: C. G. van der Post; Utrecht: C. van der Post
Jr.; Leipzig: Fried. Fleischer.
Willdenowia 50 – 2020
Nicholas A. 1992: The asclepiadaceous works of Rudolf F.
Schlechter (1872–1925). – Willdenowia 22: 215–264.
Omlor R. 1996. Notes on Marsdenieae (Asclepiadaceae) — a new, unusual species of Hoya from northern
Borneo. – Novon 6: 288 – 294.
Omlor R. 1998: Generische Revision der Marsdenieae
(Asclepiadaceae). – Aachen: Skaker Verlag.
Potgieter K. & Albert V. A. 2001: Phylogenetic
relationships within Apocynaceae s.l. based on
trnL intron and trnL-F spacer sequences and propagule characters. – Ann. Missouri Bot. Gard. 88:
523 – 549.
Rintz R. E. 1980: The Peninsular Malayan species of
Dischidia (Asclepiadaceae). – Blumea 26: 81 – 126.
Rodda M. 2015: Two new species of Hoya R. Br. (Apocynaceae, Asclepiadoideae) from Borneo. – PhytoKeys
53: 83 – 93.
Rodda M. & Ercole E. 2014: Hoya papaschonii (Apocynaceae: Asclepiadoideae), a new species from southern Thailand with a peculiar corona. – Phytotaxa 175:
97 – 106.
Rodda M. & Omlor R. 2013: The taxonomy of Oreosparte (Apocynaceae: Asclepiadoideae). – Webbia
68: 91 – 95.
Rodda M., Simonsson Juhonewe N. & Ercole E. 2013:
Hoya corymbosa (Apocynaceae, Asclepiadoideae),
a new unusual species from Sabah, Borneo, and its
systematic position based on phylogenetic analysis. –
Syst. Bot. 38: 1125 – 1131.
Sang T., Crawford D. J. & Stuessy T. F. 1997: Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). – Amer. J. Bot.
84: 1120 – 1136.
Schlechter R. 1908: Beiträge zur Kenntnis der Asclepiadaceen des Monsun-Gebietes. – Bot. Jahrb. Syst.
40(Beibl. 92): 1 – 19.
Schlechter R. 1913: Die Asclepiadaceen von DeutschNeu-Guinea. – Bot. Jahrb. Syst. 50: 81 – 164.
Schlechter R. 1915: Asclepiadaceae Philippinenses I. –
Repert. Spec. Nov. Regni Veg. 13: 537 – 544.
Simonsson Juhonewe N. & Rodda M. 2017: Contribution to a revision of Hoya (Apocynaceae: Asclepiadoideae) of Papuasia. Part I: ten new species, one new
subspecies and one new combination. – Gard. Bull.
Singapore 69: 97 – 147.
Stamatakis A. 2014: RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. – Bioinformatics 30: 1312 – 1313.
Straub S. C., Cronn R. C., Edwards C., Fishbein M. &
Liston A. 2013: Horizontal transfer of DNA from
the mitochondrial to the plastid genome and its subsequent evolution in milkweeds (Apocynaceae). –
Genome Biol. Evol. 5: 1872 – 1885.
Straub S. C., Moore M. J., Soltis P. S., Soltis D. E., Liston
A. & Livshultz T. 2014: Phylogenetic signal detection
from an ancient rapid radiation: effects of noise reduction, long-branch attraction, and model selection
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use
137
in crown clade Apocynaceae. – Molec. Phylogen.
Evol. 80: 169 – 185.
Surveswaran S., Sun M., Grimm G. W. & Liede-Schumann S. 2014: On the systematic position of some
Asian enigmatic genera of Asclepiadoideae (Apocynaceae). – Bot. J. Linn. Soc. 174: 601 – 619.
Swofford D. L. 2002: PAUP*. Phylogenetic Analysis
Using Parsimony (*and other methods). Version 4. –
Sunderland: Sinauer Associates.
Taberlet P., Gielly L., Pautou, G. & Bouvet J. 1991: Universal primers for amplification of three non-coding
regions of chloroplast DNA. – Pl. Molec. Biol. 17:
1105 – 1109.
Talavera G. & Castresana J. 2007: Improvement of phylogenies after removing divergent and ambiguously
aligned blocks from protein sequence alignments. –
Syst. Biol. 56: 564 – 577.
Tate J. A. B. & Simpson B. 2003: Paraphyly of Tarasa
(Malvaceae) and diverse origins of the polyploid species. – Syst. Bot. 28: 723 – 737.
Verhoeven R. L., Liede S. & Endress M. E. 2003: The
tribal position of Fockea and Cibirhiza (Apocynaceae: Asclepiadoideae): evidence from pollinium
structure and cpDNA sequence data. – Grana 42:
70 – 81.
Wanntorp L. & Forster P. I. 2007: Phylogenetic relationships between Hoya and the monotypic genera Madangia, Absolmsia, and Micholitzia (Apocynaceae,
Marsdenieae): insights from flower morphology. –
Ann. Missouri Bot. Gard. 94: 36 – 55.
Wanntorp L., Gotthardt K. & Muellner A. N. 2011: Revisiting the wax plants (Hoya, Marsdenieae, Apocynaceae): phylogenetic tree using the matK gene and
psbA-trnH intergenic spacer. – Taxon 60: 4 – 14.
Wanntorp L., Grudinski M., Forster P. I. & MuellnerRiehl A. N. & Grimm G. W. 2014: Wax plants (Hoya,
Apocynaceae) evolution: epiphytism drives successful radiation. – Taxon 63: 89 – 102.
Wanntorp L., Kocyan A., Donkelaar R. van & Renner S.
S. 2006b: Towards a monophyletic Hoya (Marsdenieae, Apocynaceae): inferences from the chloroplast
trnL region and the rbcL-atpB spacer. – Syst. Bot. 31:
586 – 596.
Wanntorp L., Kocyan A. & Renner S. S. 2006a: Wax
plants disentangled: a phylogeny of Hoya (Marsdenieae, Apocynaceae) inferred from nuclear and chloroplast DNA sequences. – Molec. Phylogen. Evol.
39: 722 – 733.
Wanntorp L. & Kunze H. 2009: Identifying synapomorphies in the flowers of Hoya and Dischidia — toward
phylogenetic understanding. – Int. J. Pl. Sci. 170:
331 – 342.
Wanntorp L. & Meve U. 2011: New combinations in
Hoya for the species of Clemensiella (Marsdenieae,
Apocynaceae). – Willdenowia 41: 97 – 99.
White T. J., Bruns T., Lee S. & Taylor J. 1990: Amplification and direct sequencing of fungal ribosomal RNA
138
genes for phylogenetics. – Pp. 315 – 322 in: Innis M.
A., Gelfand D. H., Sninsky J. J. & White T. J (ed.),
PCR protocols: a guide to methods and applications. – New York: Academic Press.
Yamashiro T., Fukuda T., Yokoyama J. & Maki M. 2004:
Molecular phylogeny of Vincetoxicum (Apocyna-
Rodda & al.: Phylogenetic studies in the Hoya group
ceae – Asclepiadoideae) based on the nucleotide sequences of cpDNA and nrDNA. – Molec. Phylogen.
Evol. 31: 689 – 700.
Zwickl D. J., & Hillis D. M. 2002: Increased taxon sampling greatly reduces phylogenetic error. – Syst. Biol.
51: 588 – 598.
Willdenowia
Open-access online edition bioone.org/journals/willdenowia
Online ISSN 1868-6397 · Print ISSN 0511-9618 · 2018 Journal Impact Factor 1.156
Published by the Botanic Garden and Botanical Museum Berlin, Freie Universität Berlin
© 2020 The Authors · This open-access article is distributed under the CC BY 4.0 licence
Downloaded From: https://bioone.org/journals/Willdenowia on 23 Jul 2020
Terms of Use: https://bioone.org/terms-of-use