Abstract
Background
Azolla is an important aquatic fern whose agronomic potential has not been fully exploited in Uganda. This study aimed at determining the genetic variation in the Azolla species existing in Uganda and the factors influencing their distribution in the different agro-ecological zones of Uganda. Molecular characterization was preferred in this study because of its efficiency in detecting variations among closely related species.Results
Four species of Azolla were identified in Uganda with 100, 93.36, 99.22 and 99.39% sequence identities to the reference database sequences of; Azolla mexicana, Azolla microphylla, Azolla filiculoides and Azolla cristata, respectively. These different species were distributed in four out of the ten agro-ecological zones of Uganda which are situated in close vicinity to large water masses. The principal component analysis (PCA) results revealed that maximum rainfall and altitude significantly accounted for the variations in the distribution of Azolla with factor loadings of 0.921 and 0.922, respectively.Conclusion
Massive destruction coupled with prolonged disturbance of Azolla's habitat negatively affected its growth, survival and distribution in the country. Therefore, there is a need to develop standard methods that can preserve the various species of Azolla, so as to salvage them for future use, research and reference.Free full text
Ecological distribution and genetic diversity of Azolla in Uganda
Associated Data
Abstract
Background
Azolla is an important aquatic fern whose agronomic potential has not been fully exploited in Uganda. This study aimed at determining the genetic variation in the Azolla species existing in Uganda and the factors influencing their distribution in the different agro-ecological zones of Uganda. Molecular characterization was preferred in this study because of its efficiency in detecting variations among closely related species.
Results
Four species of Azolla were identified in Uganda with 100, 93.36, 99.22 and 99.39% sequence identities to the reference database sequences of; Azolla mexicana, Azolla microphylla, Azolla filiculoides and Azolla cristata, respectively. These different species were distributed in four out of the ten agro-ecological zones of Uganda which are situated in close vicinity to large water masses. The principal component analysis (PCA) results revealed that maximum rainfall and altitude significantly accounted for the variations in the distribution of Azolla with factor loadings of 0.921 and 0.922, respectively.
Conclusion
Massive destruction coupled with prolonged disturbance of Azolla’s habitat negatively affected its growth, survival and distribution in the country. Therefore, there is a need to develop standard methods that can preserve the various species of Azolla, so as to salvage them for future use, research and reference.
Background
Azolla is a free-floating aquatic fern that is globally distributed. It preferably grows in environments with very slow or non-moving waters, such as moist soils, marshes, swamps, ponds, riverbanks and lakeshores [22]. Azolla thrives in a symbiotic association with a nitrogen-fixing cyanobacterium, Anabaena azollae [25]. The cyanobacteria provide nitrogen for themselves and their host. In turn, Azolla provides a protective environment with already fixed carbon, enabling the cyanobacteria to fix atmospheric nitrogen. This symbiotic characteristic nature of Azolla has accorded it tremendous agronomic importance as a bio-fertilizer for crops, especially in soils where nitrogen is limiting. Besides, Azolla has a huge potential for use as a livestock feed [4], biofuel [24], the feedstock of bio refineries [5], microbial culture medium [10], and wastewater treatment [3]. Despite its numerous values and thus its dubbing as a “green gold”, by many researchers, its exploitation in Uganda has been curtailed by the lack of knowledge on its identity, ecological distribution and genetic diversity.
According to the classification by the Pteridophyte Phylogeny Group (PPG I), Azolla belongs to the family Salviniaceae [21] which comprises seven species. Azolla was further divided into two sub-sections (sub-genera), namely Euazolla and Rhizosperma. Euazolla consists of five species including; Azolla microphylla Kaulf., Azolla caroliniana Willd., Azolla mexicana Schlecht.& Cham.ex K.Presl, Azolla rubra R.Br., and Azolla filiculoides Lam. Sub-section Rhizosperma consists of Azolla pinnata R.Br. and Azolla nilotica Decne. ex Mett [11, 13, 18–20].
In Uganda, by 1992, only Azolla pinnata and Azolla nilotica had been identified on Lake Victoria [30]. According to [29], Azolla. pinnata and Azolla nilotica were morphologically identified in Uganda in the regions of Kigezi, West Nile, Lake Kyoga, Lake George, Masaka, Kamuli, Jinja-Tororo highway, Namanve swamp, Kasenyi fishing village (part of Lake Victoria) and Busia. Despite the extensive studies carried out on Azolla globally, it is still difficult to identify based on morphological, physiological, and reproductive characteristics [10].
Azolla exhibits some phenotypic variations in terms of color and size among other characteristics. However, these variations may not necessarily correspond to variations in their genotypes but rather environmental influences. For instance, high temperatures can elicit stress which usually manifests in terms of color changes from green to reddish brown, following the production of anthocyanins and a reduction in chlorophyll [9, 34]. Azolla grows under; temperatures between 18 and 25°C, pH between 4.5 – 7.5 and humidity of 70-75% and a shady environment with low light intensity [23].
In Uganda, historical records about the distribution and genetic diversity of Azolla have been rendered less reliable. This is mainly attributed to the wide spread anthropogenic destruction of its habitats coupled with the less efficient methods of identification that were used in the past. We thus aimed at validating the current ecological and genetic diversity data about Azolla in Uganda, so as to pave a way for extensive studies that will contribute to unlocking of its multiple potential uses in the country.
Results
Azolla samples collected and identified as different species, were visually examined under the dissecting microscope at X 60 magnification (Fig. 1). The major difference between Azolla cristata and the other Azolla species was that the former, exhibited a lime green appearance with colorless fronds while all the rest including Azolla mexicana, exhibited darker green leaves and a pinkish substance on the fronds (Fig. (Fig.11).
Molecular characterization of Azolla
The target loci for molecular characterization of the Azolla species included; the ITS region, the trnL-trnF intergenic spacer and the region between the trnL gene and trnL-trnF intergenic spacer, utilizing different primers (Table (Table1).1). The PCR amplicons obtained were sequenced and the Sanger sequences for each species, were compared with the reference sequences in the NCBI database. Phylogenetic trees were generated following multiple sequence alignment with the reference database sequences (Fig. 2, − red star shows the Azolla species with the highest sequence identity to the sequences generated in this study).
Table 1
Primer name | Primer sequence | Reference | Targeted locus | Sequence Length (bp) |
---|---|---|---|---|
ITS1 ITS4 | 5′ TCCGTAGGTGAACCTGCGG 3′ 5′ TCCTCCGCTTATTGATATGC 3′ | [32] | Internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2 | 984 |
N-F N-R | 5′ GGTTCAAGTCCCTCTATCCC 3′ 5′ ATTTGAACTGGTGACACGAG 3′ | [26] | trnL – trnF intergenic spacer | 409 |
SCAR-F SCAR-R | 5′GACATATCCACCTATCGTCTCTGTC 3′ 5′AGACAACTTCGATAGTCACAGTTCC 3′ | [1] | Internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2 | 842 |
18Sr-F 18Sr-R | 5′ AGGGTTCGATTCCGGAGA 3′ 5′ CCTTCCGTCAATTCCTTTAAG 3‘ | [6] | trnL gene and trnL-trnF intergenic spacer | 1029 |
These generated sequences species were assigned new accession numbers after deposition in the NCBI Genbank repository as; OP245087, OP216245, OP218941 and OP218958 (Table 2). The new accessions showed 100, 93.36, 99.22 and 99.39% sequence identities to Azolla mexicana (Fig. (Fig.2A),2A), Azolla microphylla (Fig. (Fig.2B),2B), Azolla filiculoides (Fig. (Fig.2C)2C) and Azolla cristata (Fig. (Fig.22D), respectively.
Table 2
No. | Agro-ecological zone | Azolla species identified |
---|---|---|
1. | Kyoga plains | A. cristata |
2. | Lake Victoria Crescent | A. mexicana, A. microphylla, A. cristata |
3. | Para Savannah | A. Mexicana |
4. | Western savannah grasslands | A. microphylla, A. filiculoides, A. cristata |
5. | North Eastern drylands | None |
6. | Highland Ranges | None |
7. | North Eastern savannah grasslands | None |
8. | North Western savannah grasslands | None |
9. | Pastoral rangelands | None |
10. | South Western Farmlands | None |
Ecological distribution
The map (Fig. 3) illustrates how Azolla was distributed within the ten agro-ecological zones of Uganda at the time of the survey and sample collection. From the map it is absolutely clear that Azolla species were distributed in wetlands of only four agro-ecological zones which were in close vicinity to large water masses (Fig. (Fig.33 and Table Table3).3). Despite scanning all the ten agro-ecological zones, no traces of Azolla were identified in any of the remaining six zones.
Table 3
Taxon | Herbarium Voucher ID | GenBank accession no. |
---|---|---|
Azolla microphylla | MUK:PMB:NLF:1 | OP216245 |
Azolla mexicana | MUK:PMB:NLF:2 | OP245087 |
Azolla cristata | MUK:PMB:NLF:3 | OP218958 |
Azolla filiculoides | MUK:PMB:NLF:4 | OP218941 |
Environmental influences on the distribution of Azolla in Uganda
Data on pH and mineral nutrient concentrations (Ca, Mg, N, P and K) in water samples was analyzed together with altitude and annual average climatic data (rainfall and temperature), to determine their influence on the distribution of Azolla species in Uganda (Fig. 4).
The PCA biplot, demonstrated that only maximum rainfall and altitude with factor loadings of 0.921 and 0.922, respectively influenced the distribution of Azolla. All other factors exhibited no significant influence as supported by factor loadings of <0.01. This signified the existence of other underlying factors that probably influenced this distribution.
Discussion
Molecular characterization of Azolla
The high percentage identity of the four sequences aligned with the reference sequences indicated a very close linkage to the database species. Based on these results, it was confirmed that the sample species were similar to the known database species. Thus, it was deduced that four species of Azolla namely; A. mexicana, A. microphylla, A. filiculoides and A. cristata existed in Uganda at the time of this study.
According to [30] two species namely; Azolla pinnata and Azolla nilotica were earlier identified from Lake Victoria regions and other parts of Uganda using morphological methods. According to [29], Azolla pinnata was identified on Nyamuriro wetland in Kigezi and Bulamogi in Kamuli district along Lake Kyoga near the floating papyrus vegetation. Other places included along Lake George in Western Uganda, Jinja -Tororo road, Mpigi swamp in Central region, and Bukoto county in Masaka district. Azolla nilotica was found in Queen Elizabeth National Park, Namanve swamp along R. Nile, Ssese islands and in West Nile region along R. Nile. Despite these past discoveries, this study did not identify any of the two species as discovered earlier. According to [10] morphological, physiological and reproductive structural identification of Azolla species is still difficult and unclear. Basing on this argument, and the method of identification employed at that time, this scenario creates suspicions of a probable misapplication of names. To further strengthen this argument, according to [12], there was a study conducted on a biological control experiment to eliminate Azolla pinnata subsp. Africana using Stenopelmus rufinasus (a water fern weevil). During this experiment, it was observed that Azolla pinnata was not the right host for Stenopelmus rufinasus. On conducting further analysis on Azolla pinnata to determine its true identity using molecular tools, it was proven that this species was instead Azolla cristata and not Azolla pinnata. This implied that the failure of that experiment was due to employment of a wrong biological control agent. More so, from this study, some of the agro-ecological zones where Azolla cristata was identified are synonymous with the regions where Azolla pinnata was earlier discovered. Further still, from the general appearance of Azolla pinnata as per the Makerere University Herbarium specimen archives, its fronds present a dark green appearance with a pinkish component (Fig. (Fig.1)1) most likely due to anthocyanin production. Since Azolla mexicana, Azolla microphylla and Azolla filiculoides all present a similar appearance, it could probably be assumed that Azolla pinnata identified earlier was actually one of the three above species. Azolla cristata instead, exhibits a lime green appearance with colorless fronds (Fig. (Fig.1).1). It is not clear whether Azolla cristata existed earlier since there are no records of its discovery as per the University Herbarium archives. Thus, it could be assumed as a new species that colonized these different regions. The new species could probably have been introduced indirectly by aquatic fowls and flowing water or even directly by man.
Despite having been documented as earlier discovered, Azolla nilotica was not identified anywhere as per this study. It is also unclear whether it was as well due to misapplication of a name or extinction the species. The specimens of Azolla nilotica as per the Herbarium archives exhibit a unique size of Azolla which was never observed in this study. Based on its unique features especially the size, there was no species among the four which appeared similar to it. This implies that it probably neither existed at the time of this study nor was it a misapplication of a name. Nonetheless, it is plausible that Azolla nilotica was out-competed by the onset of Eichornia crassipes (water hyacinth) on Lake Victoria. According to [15], the colonization of Eichornia crassipes pushed other macrophytes to the shores including Azolla nilotica, pistia stratiotes, Vossia cuspidate among others. Being smaller than other macrophytes, Azolla nilotica formed a substrate mass which later provided nutrients for growth of other competing macrophytes. Further still, the evolutionary fact of life steered by human pressures that created the unfavorable environment, coupled with climate change, [23] could also have contributed to the complete disappearance of A. nilotica from those regions.
Ecological distribution of Azolla
From the PCA biplot (Fig. (Fig.4),4), only maximum rainfall and altitude showed a significant influence on the distribution of Azolla. The factor of maximum rainfall could be explained by the tendency of heavy rains to supply lots of water. With an overflow from large water masses into surrounding areas and swamps, a water-logged environment is created enabling Azolla’s growth and continuous distribution as water flows. An example is in the Para Savannah agro-ecological zone along Albert Nile, where A. mexicana was found stuck in the nearby vegetation. This implies that it was probably being carried along with the flowing water but remained stuck and was later identified there. Further still, distribution could also be by aquatic fowls and other organisms [31] as they move from place to place carrying spores alongside. These spores can be deposited anywhere and if conditions turn out favorable, they germinate forming mature plants.
A high altitude negatively influenced the distribution of Azolla according to the PCA results. This could be attributed to the reduced water levels, a factor that does not support growth of Azolla. Further still, at high altitude, there is an increase in exposure to environmental stresses that affect species distribution. Among these are the reduced levels of micronutrients arising from low mineralization thereby, lowering the pH [8].
Topography was another factor that probably contributed to the absence of Azolla, in the Highland ranges and the South Western farmlands of Uganda. Azolla requires conditions of no or very slow-moving water to thrive. However, in these two agro-ecological zones, the nature of the land is mountainous thus the water flow coming down from the hills is always very fast [28]. This condition hinders the growth and survival Azolla.
The North Eastern drylands, North Western Savannah grasslands, North Eastern Savannah grasslands and the Pastoral rangelands mostly possess seasonal wetlands with animal grazing as the main activity [28]. Most of the swamps that were scanned in these regions were contaminated with unclean water from disruption by drinking animals coupled with waste dumping. The prolonged disturbance causing consistent turbulence of water hinders Azolla’s growth and survival [23]. This probably explains its absence in those regions.
Population pressure was another observed factor that affected Azolla’s growth, survival and distribution. Uganda is a country with several wetlands. However, owing to population growth coupled with the scarcity of land, wetlands which constitute the major habitat for Azolla have been severely encroached upon. The egocentric character of man coupled with ignorance about the benefits of Azolla account for the massive clearance of its habitats. This is conducted in favor of several activities including agriculture, bricklaying, construction of settlements, fishing and animal grazing [28]. Despite all trials for its elimination, Azolla is still able to regenerate when favorable conditions are availed due to its invasive nature thus enabling its persistence in the environment.
The mineral nutrients analyzed were expected to have a significant influence on the distribution of Azolla, since they are among the major macronutrients required for growth of plants. However, PCA results showed no significant influence, an issue that could probably be attributed to the constantly fluctuating mineral nutrient concentrations in the wild environment.
From the map (Fig. (Fig.3)3) Azolla was identified in four out of the ten agro-ecological zones of Uganda. Despite this, there is no clear evidence that Azolla exists only in these areas. Azolla is known to grow and thrive under specific conditions including temperature between 18 and 25°C, a shady environment with low light intensity, pH4.5 – 7.5 and humidity of 70-75% [23]. When conditions become extremely unfavorable it may die and its spores regenerate later when appropriate conditions return. This explains why in some areas where it was collected, its color was turning from green to reddish brown. This change is due to production of more anthocyanins and less chlorophyll following environmental stresses like elevated temperatures [9, 34]. However, when appropriate conditions resume, more chlorophyll is produced with less anthocyanins stimulating the regeneration of the green color.
Conclusion
This study identified four different species of Azolla namely; Azolla Mexicana, Azolla microphylla, Azolla filiculoides, and Azolla cristata. These species were majorly identified in four agro-ecological zones including Lake Victoria crescent, Kyoga plains, Para Savannah and Western Savannah grasslands which are in close vicinity to large water masses. The only two species which had been discovered previously were not identified in this study. This implied that it was either a misapplication of a name, replacement by new species or probably out competition by other macrophytes, as for the sake of Azolla nilotica. Maximum rainfall significantly influenced the growth of Azolla unlike a high altitude. The major observed factors that affected the growth and distribution of Azolla were anthropogenic factors which enhance turbulence and favor ecosystem disturbance. The other factor was topography characterized by hilly and mountainous areas that cannot favor smooth and slow-moving water required for the survival of Azolla.
Recommendation
There is a need to develop standard methods of preserving Azolla for future use, research and reference considering the rate of wetland clearance in Uganda. Further still, investigations on the two unidentified species during the study; i.e. A. pinnata and A. nilotica need to be made to confirm whether it was a taxonomic name misapplication or actual disappearance of species resulting from several causes. More studies on the ecological distribution of the different species of Azolla in Uganda should be conducted, to determine the factors influencing their existence in a location over a reasonable period of time.
Materials and methods
Scope of the study
Uganda is a landlocked country lying within the equatorial region with a latitude of 1.3733° N, and a longitude of 32.2903° E. It occupies 241,550.7 Km2 of land, with open water and swamps constituting 41,743.2 Km2 [14]. Most of these water bodies are supplied by rainfall. Some rivers drain into wetlands while other wetlands arise from underground water trickling out of aquifers.
Study area
Agro-ecological zones characterized by wetlands with slow moving waters and drained with waters from different major rivers in Uganda were selected for the study to obtain a representative sample for the entire country. Both permanent and seasonal wetlands were considered as part of the sampling zones. These agro-ecological zones included; Highland ranges, Kyoga plains, Lake Victoria Crescent, North Eastern drylands, North Eastern Savannah grasslands, North Western Savannah grasslands, Para Savannah, Pastoral ranges, South Western farmlands, and Western Savannah grasslands [16]. The study was registered and approved by the National Council of Science and Technology with an approval number of UNCST/RCI/94811239. Permission to carry out a country wide survey in search of Azolla was also provided.
Sampling procedure
During sampling, wetlands within the same hydrological region drained by the same river were assumed to be harboring the same species of Azolla and were thus partially scanned. Because Azolla is an aquatic plant, purposive sampling was done mainly from wetlands of different agro-ecological zones to obtain representative samples for a particular area. Majority of the sites where Azolla was collected were characterized by water-logged clay soils with papyrus as the dominant vegetation forming a swampy environment. Other places included ponds that had been abandoned after bricklaying, while others were plantations in wetlands as well as some shore zones of weedy channels that allow limited water flow. Azolla was collected during the rainy season in the months of November 2019, January, March, August, and November 2020. The sites where Azolla was collected ranged between 680 and 1308m above sea level although there were still other sites within the same altitude where Azolla was not found.
Azolla specimens were initially identified by a senior taxonomist Mr. Rwabulindooli from the Makerere University herbarium. After confirming that the material sampled was Azolla, massive sample collection commenced. The collected Azolla samples were packed in well labelled 50ml falcon tubes and transferred into a cold box maintained at 4°C. These were then transported to the Molecular diagnostic laboratory in the Department of Plant Sciences, Microbiology, and Biotechnology at Makerere University. From the same spot where Azolla was collected, a corresponding water sample was collected into a well labelled water sample bottle, transferred into a cold box to the Geochemistry laboratory at Makerere University for mineral nutrient analysis.
Morphological characterization of the Azolla samples
Azolla mexicana having had a similar appearance to Azolla microphylla and Azolla filiculoides was selected for morphological characterization in comparison with Azolla cristata. A section of these was mounted on to a slide of a dissecting microscope connected to the computer and the image viewed under X60 magnification.
Chemical analysis of the water samples
Water was analyzed for the presence of dissolved calcium, phosphorus, nitrogen, potassium, and magnesium using the Atomic Absorption Spectrophotometer (AAS) [17].
DNA extraction
The samples of Azolla stored at 4°C were retrieved after 1 day. About 200mg of Azolla tissue was first cleaned with distilled water and ground into a fine powder using a sterile mortar and pestle under liquid nitrogen. DNA extraction was carried out using the Bioron Plant DNA Mini Kit according to Manufacturer’s instructions (BIORON Diagnostics GmbH, Römerberg, Germany). The concentration and quality of the extracted DNA were determined using 1% gel electrophoresis and a NanoDrop One C spectrophotometer (Thermo Fisher Scientific, Madison, USA). The isolated genomic DNA was then stored at −20°C until use.
DNA amplification and sequencing
In this study, DNA amplification was successfully conducted using four different primer sets (Table (Table1).1). The PCR product was prepared in a total volume of 25μl containing One Taq Quick-load 2X Master Mix (New England BioLabs Inc., Cat.No.: MO486S), 0.2μM of each primer and 250ng/μl of DNA template or same concentrations of Q5 Hot start High Fidelity Master Mix from (New England Biolabs, USA) for difficult amplifications. The mixture was topped up to 25μl with nuclease-free water. Amplification was carried out in an XP Thermal cycler (Hangzhou Bioer Technology Co, Ltd., Hangzhou, China). All reactions were performed for 35cycles with the following conditions; Initial denaturation at 94°C for 3minutes and 20seconds, denaturation at 94°C for 25seconds, annealing at 53°C for 30seconds, extension at 72°C for 50seconds and the final extension at 72°C for 5minutes.
Gel electrophoresis
The amplification success was checked by 1.5% agarose gel stained with ethidium bromide. Electrophoresis was carried out for 1[1]/2 hours at 100V with a current of 300 A. Gel images were then viewed under a UV trans illuminator (Model: PS300TP, Taiwan).
Sanger sequencing
PCR products were purified and sequenced by ‘Intergen Genetics and Rare Diseases Diagnosis and Research Centre’ in Turkey using standard operating procedures.
Phylogenetic analysis
Sequences were edited using the BioEdit biological sequence alignment editor version 7.2 [Hall, 1999]. Basic Local Alignment Search Tool (BLAST) searches were applied to all produced sequences using National Centre for Biotechnology Information (NCBI/GenBank) databases. A megablast was conducted (Nucleotide BLAST) with highly similar sequences considered [2]. At genus level, identification was considered as successful when all hits with maximal percentage identity scores >98% involved a single genus. Species identification was considered successful only when the highest maximal percentage identity included a single species and scored >90% [33]. All sequences were matched with the query sequences and available sequences of Azolla in order to determine the best matching species. The phylogenetic trees were generated using blast pairwise alignment and the sample sequences were aligned with the database sequences. The final images were downloaded into a Newick file for editing into final scaled phylogenetic trees using Molecular Evolutionary Genetics Analysis version 11 (MEGA 11) software [27].
Specimen deposition in the university herbarium and NCBI GenBank
After confirmation of species with molecular tools, four specimens corresponding to the four different species were deposited in the Makerere University Herbarium where they were assigned voucher numbers by Mr. Rwabulondooli Protase, a senior taxonomist in the University. The four species’ sequence data was also submitted to NCBI GenBank repository and accession numbers were assigned.
Environmental conditions for the sample collection sites
Data on pH, altitude and average annual climate (temperature and rainfall) was collected between 2011 and 2021 and analyzed.
Data analysis
To determine the influence of the parameters under study (mineral nutrients, pH, altitude and climatic data) on the distribution of Azolla in different agro-ecological zones, the principal component analysis (PCA) was computed using PAST [7].
Acknowledgements
We are so grateful to the entire team of MAPRONANO ACE for the financial support provided. Special thanks to the entire team that participated in the countrywide collection of samples including Ms. Juliet Namigadde and Mr. Jamil Miiro. Special thanks go to all the people from various communities that guided us as we made our search for Azolla in the field. We sincerely appreciate the excellent work of Mr. Rwabulindooli Protase a senior taxonomist in Makerere University who assisted in the identification of Azolla. We also thank Mr. Paul Ssemanda for his assistance during the laboratory analysis and all the members of the Department of Plant Sciences, Microbiology and Biotechnology who provided guidance and moral support during execution of this work.
Authors’ contributions
Nabyonga Lydia conceived the idea and participated in sample collection, laboratory analysis, data analysis, manuscript writing, and editing. Twaha Basamba participated in data collection and manuscript revision. Clement Nyakoojo participated in data collection and manuscript revision. Ntambi Saidi participated in sample collection, laboratory analysis and data analysis. Abubakar Sadik Mustafa participated in data analysis and manuscript revision. Gerald M. Mutumba participated in manuscript revision. Jamilu E. ssenku conceived the idea, participated in sample collection, data analysis and manuscript revision. The author(s) read and approved the final manuscript.
Funding
This research project was funded by Africa Centre of Excellence in Materials, Product Development & Nanotechnology; MAPRONANO ACE, Grant No. P151847IDA credit 5797-UG, College of Engineering Design Art and Technology, Makerere University.
Availability of data and materials
Sequence datasets generated and analyzed during the current study were deposited in the NCBI GenBank repository and assigned accession numbers as; OP245087, OP216245, OP218941, and OP218958. These are currently publicly available when searched using the following links.
https://www.ncbi.nlm.nih.gov/nuccore/OP216245.1https://www.ncbi.nlm.nih.gov/nuccore/OP218941.1https://www.ncbi.nlm.nih.gov/nuccore/OP218958.1https://www.ncbi.nlm.nih.gov/nuccore/OP245087.1
The other datasets used during the current study are available from the corresponding author on reasonable request.
Declarations
The study was registered and approved by the National Council of Science and Technology with an approval number of UNCST/RCI/94811239. All methods were performed in accordance with the relevant guidelines/regulations/legislation.
Not applicable.
There are no competing interests amongst all authors.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
Articles from BMC Plant Biology are provided here courtesy of BMC
Full text links
Read article at publisher's site: https://doi.org/10.1186/s12870-023-04146-6
Read article for free, from open access legal sources, via Unpaywall: https://bmcplantbiol.biomedcentral.com/counter/pdf/10.1186/s12870-023-04146-6
Citations & impact
This article has not been cited yet.
Impact metrics
Alternative metrics
Discover the attention surrounding your research
https://www.altmetric.com/details/144172689
Data
Data behind the article
This data has been text mined from the article, or deposited into data resources.
Nucleotide Sequences (3)
- (2 citations) ENA - OP216245
- (2 citations) ENA - OP218941
- (2 citations) ENA - OP218958
Similar Articles
To arrive at the top five similar articles we use a word-weighted algorithm to compare words from the Title and Abstract of each citation.
Comparative analysis of the endophytic bacteria inhabiting the phyllosphere of aquatic fern Azolla species by high-throughput sequencing.
BMC Microbiol, 22(1):246, 11 Oct 2022
Cited by: 0 articles | PMID: 36221067 | PMCID: PMC9552495
Genetic diversity among and within cultured cyanobionts of diverse species of Azolla.
Folia Microbiol (Praha), 53(1):35-43, 15 May 2008
Cited by: 6 articles | PMID: 18481216
Jasmonic and salicylic acid response in the fern Azolla filiculoides and its cyanobiont.
Plant Cell Environ, 41(11):2530-2548, 07 Feb 2018
Cited by: 9 articles | PMID: 29314046
Impact of High Light Intensity and Low Temperature on the Growth and Phenylpropanoid Profile of Azolla filiculoides.
Int J Mol Sci, 24(10):8554, 10 May 2023
Cited by: 1 article | PMID: 37239901 | PMCID: PMC10218715
Aquatic microphylla Azolla: a perspective paradigm for sustainable agriculture, environment and global climate change.
Environ Sci Pollut Res Int, 23(5):4358-4369, 23 Dec 2015
Cited by: 17 articles | PMID: 26697861
Review
Funding
Funders who supported this work.
MAPRONANO ACE (1)
Grant ID: Grant No. P151847IDA credit 5797-UG,